SBB09 Construct19

From OpenWetWare

Jump to: navigation, search

Construction of Cellulose-binding Knottin {<CBK>} basic part M10046 (Bdvs003)
PCR Odvs003F/Odvs003R on CBK                        (160bp, EcoRI/BamHI)
Sub into pBca9495AK-Bca1144#5                       (EcoRI/BamHI, 3171+910, L)
Product is pBca9495AK-M10046          {<CBK>}       (3315bp)
----
Odvs003F    Forward construction of CBK basic part       ccataGAATTCATGAGATCTGGTTCTGGTCCGACCCAGTCTCACTACGG
Odvs003R    Reverse construction of CBK basic part       ctgatGGATCCACCAGAACCCAGGCACTGAGAGTAGTACGG

 JCA:  There is no template for knottin, it needs to be synthesis.  See revised below:
Combine 10pmol each of Odvs003,Odvs004,Odvs005,Odvs006
Run 55 program
Use product as template for:

PCR Odvs003/Odvs006 on assembly product (160bp, EcoRI/BamHI)
Product is pBca9495AK-M10046          {<CBK>}
--------------------------------------
Odvs003	Gene Synthesis of CBK basic part	CCATAGAATTCATGAGATCTGGTTCTGGTCCGACCCAGTCTCACTACGGTCAGTGCG
Odvs004	Gene Synthesis of CBK basic part	CGCAAACGGTCGGACCAGAGTAACCGATACCACCGCACTGACCGTAGTGAGACTG
Odvs005	Gene Synthesis of CBK basic part	CTCTGGTCCGACCGTTTGCGCTTCTGGTACCACCTGCCAGGTTCTGAACCCGTACTAC
Odvs006	Gene Synthesis of CBK basic part	GCTTAGGATCCACCAGAACCCAGGCACTGAGAGTAGTACGGGTTCAGAACCTGGC
Personal tools