SBB09 Construct16

From OpenWetWare

Jump to: navigation, search
 Construction of {<Chal>} basic part from pBca9145-Jtk2031 
 PCR ca998 and Odmd003R on pBca9145-Jtk2031           (510bp, EcoRI/BamHI)
 Sub into pBca9495AK-Bca1144#5                        (EcoRI/BamHI, 3171+910, L)
 Product is pBca9495AK-M10051 			      {<Chal>}
 ----------------------------
 ca998	    Forward Sequencing of pSB1A2/pSB1A3          gtatcacgaggcagaatttcag  
 Odmd003R   Reverse Oligo for Chal Lectin w/o Stop Codon ccaaaGGATCCctcgctgtcgtcctctcgta 
Personal tools