Ring B sequences

From OpenWetWare

Jump to: navigation, search


6HB-A-CS: TGTCAACGCATGATACACGCC (21mer)
6HB-A-LS: GTAAGTGGTTGACAGGCGTGT (21mer)
6HB-B-CS-: CCTGGAACACTTACCTCTAA (20mer)
6HB-B-LS: TTCCAGGTTAGGAGGCACTGC (21mer)
6HB-C-CS-: ATCCAAGCAGTGCCTACCGG (20mer)
6HB-C-LS: TTATGGCTTGGACTCCGGTAG (21mer)
6HB-D-CS: TGTGGTCGCCATAAGTGAGAT (21mer)
6HB-D-LS: GACCACAATCTCACTGAACTC (21mer)
6HB-E-CS+: CATTCGTTAGAGTTCATTCTTCG (23mer)
6HB-E-LS: TACCAGTTACGATGCGAAGAA (21mer)
6HB-F-CS+: ATTCATTACTGGTACAACCTCGA (23mer)
6HB-F-LS: AATGAATTCAGTTGATCATGC (21mer)


6HB-E-CS+ is modified from the original; T is inserted in the forth from the left.
6HB-F-CS+ is modified from the original; C is inserted in the fifth from the right.

The title of the original paper is "Self-Assembly of DNA Rings from Scaffold-Free DNA Tiles"

Personal tools