Registry/Measurement kit/Notebook/2007-7-4

From OpenWetWare

Jump to: navigation, search

Contents

Colony PCR

  • Yet again, yesterday's PCR seems to have evaporated...
    • Trying again with a different tube.

E0240

  • Made glycerol stocks of colonies 3,4,6 and mini-prepping the remaining 4mL.
    • Will send for sequencing today.
  • Sequencing order: 3F, 3R, 4F, 4R, 6F, 6R

I2057

  • Sequence matches!

T9002

  • Starting sequential digest (MfeI, then NsiI).

Primers

  • Need scarring primers for I2056, I2057
    • I2056:
      • F: Same as I2055
      • R: same as I2055
    • I2057:
      • F: CTTAGTAG CAATTG TCACACAGGAAAGTACTAGATGGC (52.1)
      • R: same as I2055
Personal tools