Registry/Measurement kit/Notebook/2007-6-19

From OpenWetWare

Jump to: navigation, search

Contents

Colony PCR

  • Growth only on the Kan plate with Device B (GFP rbs tester, R0040 + I13401), doing a verification PCR on 8 of these colonies.
    • Spun down cultures with other devices, plating them for overnight.
  • See Endy:Colony_PCR
    • note: 72° is the extension step. taq is in shared polymerase box in first room

Prepared chemically competent cells

  • see protocol
  • made stocks of MG1655 and top10
    • note: need more TSS buffer!

Analytic Gel of Colony PCR

  • All but 2 had the right size. (will upload image soon) Choosing colony #8 for sequencing tomorrow.
    • note: ladder in Controls box in -20, loading buffer in -4.
  • Made overnight culture of colony 8.

Ordered primers for E0240

  • E0240_F -- CTTAGTAG CAATTG TCACACAGGAAAGTACTAGATGCG
  • E0240_R -- TCAGCCAT ATGCAT TATAAACGCAGAAAGGCCCAC
    • in Vector NTI, go to analysis -> oligo analysis

Bold is tail, italics is restriction site.

Personal tools