Mike Barnkob:Protocols/CRISPR/Screening for inserts

From OpenWetWare

Jump to: navigation, search

Front page

Contents

Screening for inserts

Basic steps for screening for inserts.

Reagents

  • Transformed bacteria
  • Sterile pipet-tips.


Protocol

Colony PCR and liquid cultures:

  1. After having transformed bacteria, pick 5-10 colonies from each plate with pipet-tip.
  2. ...

Miniprep good colonies:

  1. [[Mike_Barnkob:Protocols/Bacterial/Isolate_DNA|Isolate plasmid DNA from transformed bacteria].

Send DNA to sequecing:

Check sequences: Go through these basic steps to ensure that the transformed bacteria have the correct alignment and contain the right construct:

  1. Check sequencing quality in FinchTV:
    • Search for gRNA sequence.
    • Check quality values: you want to see good chromotographic values as compared to background.
      Note: Beginning of data is usually of low quality.
  2. Copy sequence to SnapGene:
    • Find the following features:
      1. Top strand of gRNA oligo
      2. gRNA scaffold: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT
      3. Filler between gRNA scaffold and EFS: GAATTCGCTAGC
      4. EFS: TAGGTCTTGAAAGGAGTGGGAATTGGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGATCCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGG
      5. Filler between EFS and Cas9: ACCGGTTCTAGAGCGCTGCCACC
      6. Beginning of Cas9: ATGGACAAGAAGTACAGCATCGGCCTGGACATCGGCACCAACTCTGTGGGCTGGGCCGTGATCACCGACGAGTACAAGGTGCCCAGCAAGAAATTCAAGGTGCTGGGCAACACCGACCGGCACAGCATCAAGAAGAACCTGATCGGAGCCCTGCTGTTCGACAG
    • Check that extra bases have not been inserted between features.
    • Align sequence against backbone sequence.
      Note: The beginning and end of the sequence is often of low quality, so pay most attention to the sequences after the first 100bp or so.

References

Programs:

Personal tools