Matt Gethers/CRI, Thailand/Specifications/BT2737

From OpenWetWare

Jump to: navigation, search

Reverse Primer BT2737 (5' to 3')

Extra Bases (For cutting efficiency) BamHI Site Annealing Bases
cgcggatccgctcggagactgcgtcat

Specs

LENGTH (annealing/all): 18/27

GC CONTENT (not including non-anealing bases): 61.1 %

MELT TEMP (not including non-annealing bases): 57.4 ºC

Min(ΔG): -4.01 kcal.mole-1

Stock Concentration: 100 μM

Personal tools