List of UNSes

From OpenWetWare

Jump to: navigation, search

List of Already-Designed UNSes

All current UNSes have been designed to minimize secondary structure under isothermal assembly conditions, to minimize cross-annealing to one another, and to minimize biological activity (no start codons, bacterial promoter-like sequences, or sequences with high BLAST scores to the E. coli genome). These UNSes were generated algorithmically as described previously.


U1: CATTACTCGCATCCATTCTCAGGCTGTCTCGTCTCGTCTC

U2: GCTGGGAGTTCGTAGACGGAAACAAACGCAGAATCCAAGC

U3: GCACTGAAGGTCCTCAATCGCACTGGAAACATCAAGGTCG

U4: CTGACCTCCTGCCAGCAATAGTAAGACAACACGCAAAGTC

U5: GAGCCAACTCCCTTTACAACCTCACTCAAGTCCGTTAGAG

U6: CTCGTTCGCTGCCACCTAAGAATACTCTACGGTCACATAC

U7: CAAGACGCTGGCTCTGACATTTCCGCTACTGAACTACTCG

U8: CCTCGTCTCAACCAAAGCAATCAACCCATCAACCACCTGG

U9: GTTCCTTATCATCTGGCGAATCGGACCCACAAGAGCACTG

UX: CCAGGATACATAGATTACCACAACTCCGAGCCCTTCCACC

Personal tools