Light my XYZ: Material from Austin

1. Primer Sequences for amplification

• proteorhodopsin-fwd
  • accatgggtaaattattactgatattagg

• proteorhodopsin-rev
  • AGCATTAGAAGATTCTTTAACAGC

• proteorhodopsin-BB-fwd (contains BioBricks+RBS sequence)
  • ccttgaattcgcggccgcttctagagaaagaggagaaattaagcaccatgggtaaattattac

• proteorhodopsin-BB-rev
  • CCTTCTGCAGCGGCCGCTACTAGTATTAAGCATTAGAAGATTC

These have been ordered from IDT, diluted to 100pmol/ul and are now stored in BE.109 teaching lab as NO###-NO###.

2. Protocols from Austin email 08/01/05--Thank you Austin

• roughly my protocol for isolating from Boston Harbor:

   collect some water, centrifuge, remove liquid, add more liquid,
   repeat several times. also tried filtering the water.
   
   PCR with proteorhodopsin-fwd and proteorhodopsin-rev.
   
   one of the unfiltered samples out of 2 gave me a decent band. none
   of the filtered samples worked.

   TOPO TA cloned the PCR
   Re-PCR with the BioBricks primers
   3 BioBricks sites in sequence mutated out
   Plac attached via standard BioBricks cloning

3. Clones from Austin

• PR clone #3 in pSB103 stored in XL1-blue (NB174)
• PR clone #4 under control of lac promoter in pSB103 in XL1-blue (NB175)
• PR clone #4 under control of lac promoter in pSB103 in BL21 (NB176)
• PR clone #4 in pSB103 in DH5alpha (NB177)

NB174 and NB175 were gifts of DNA that were transformed by me then frozen down. Next step will be to sequence and verify that these are PRs