Koch Lab:Protocols/Sequences/pRL574

From OpenWetWare

Jump to: navigation, search
Add to My Links

Notes

  • Sequence for pRL574, from email from Bob Landick.

Sequence

5' CGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATAAAATTGTAAACGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGCCCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCAAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTACTATGGTTGCTTTGACGTATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTCGAGCTCGGTACCCGATCCAGATCCCGAACGCCTATCTTAAAGTTTAAACATAAAGACCAGACCTAAAGACCAGACCTAAAGACACTACATAAAGACCAGACCTAAAGACGCCTTGTTGTTAGCCATAAAGTGATAACCTTTAATCATTGTCTTTATTAATACAACTCACTATAAGGAGAGACAACTTAAAGAGACTTAAAAGATTAATTTAAAATTTATCAAAAAGAGTATTGACTTAAAGTCTAACCTATAGGATACTTACAGCCATCGAGAGGGACACGGGGGATCCTCTAGAGTGCTTGGCGAACCGGTGTTTGACGTCCAGGAATGTCAAATCCGTGGCGTGACCTATTCCGCACCGCTGCGCGTTAAACTGCGTCTGGTGATCTATGAGCGCGAAGCGCCGGAAGGCACCGTAAAAGACATTAAAGAACAAGAAGTCTACATGGGCGAAATTCCGCTCATGACAGACAACGGTACCTTTGTTATCAACGGTACTGAGCGTGTTATCGTTTCCCAGCTGCACCGTAGTCCGGGCGTCTTCTTTGACTCCGACAAAGGTAAAACCCACTCTTCGGGTAAAGTGCTGTATAACGCGCGTATCATCCCTTACCGTGGTTCCTGGCTGGACTTCGAATTCGATCCGAAGGACAACCTGTTCGTACGTATCGACCGTCGCCGTAAACTGCCTGCGACCATCATTCTGCGCGCCCTGAACTACACCACAGAGCAGATCCTCGACCTGTTCTTTGAAAAAGTTATCTTTGAAATCCGTGATAACAAGCTGCAGATGGAACTGGTGCCGGAACGCCTGCGTGGTGAAACCGCATCTTTTGACATCGAAGCTAACGGTAAAGTGTACGTAGAAAAAGGCCGCCGTATCACTGCGCGCCACATTCGCCAGCTGGAAAAAGACGACGTCAAACTGATCGAAGTCCCGGTTGAGTACATCGCAGGTAAAGTGGTTGCTAAAGACTATATTGATGAGTCTACCGGCGAGCTGATCTGCGCAGCGAACATGGAGCTGAGCCTGGATCTGCTGGCTAAGCTGAGCCAGTCTGGTCACAAGCGTATCGAAACGCTGTTCACCAACGATCTGGATCACGGCCCATATATCTCTGAAACCTTACGTGTCGACCCAACTAACGACCGTCTGAGCGCACTGGTAGAAATCTACCGCATGATGCGCCCTGGCGAGCCGCCGACTCGTGAAGCAGCTGAAAGCCTGTTCGAGAACCTGTTCTTCTCCGAAGACCGTTATGACTTGTCTGCGGTTGGTCGTATGAAGTTCAACCGTTCTCTGCTGCGCGAAGAAATCGAAGGTTCCGGTATCCTGAGCAAAGACGACATCATTGATGTTATGAAAAAGCTCATCGATATCCGTAACGGTAAAGGCGAAGTCGATGATATCGACCACCTCGGCAACCGTCGTATCCGTTCCGTTGGCGAAATGGCGGAAAACCAGTTCCGCGTTGGCCTGGTACGTGTAGAGCGTGCGGTGAAAGAGCGTCTGTCTCTGGGCGATCTGGATACCCTGATGCCACAGGATATGATCAACGCCAAGCCGATTTCCGCAGCAGTGAAAGAGTTCTTCGGTTCCAGCCAGCTGTCTCAGTTTATGGACCAGAACAACCCGCTGTCTGAGATTACGCACAAACGTCGTATCTCCGCACTCGGCCCAGGCGGTCTGACCCGTGAACGTGCAGGCTTCGAAGTTCGAGACGTACACCCGACTCACTACGGTCGCGTATGTCCAATCGAAACCCCTGAAGGTCCGAACATCGGTCTGATCAACTCTCTGTCCGTGTACGCACAGACTAACGAATACGGCTTCCTTGAGACTCCGTATCGTAAAGTGACCGACGGTGTTGTAACTGACGAAATTCACTACCTGTCTGCTATCGAAGAAGGCAACTACGTTATCGCCCAGGCGAACTCCAACTTGGATGAAGAAGGCCACTTCGTAGAAGACCTGGTAACTTGCCGTAGCAAAGGCGAATCCAGCTTGTTCAGCCGCGACCAGGTTGACTACATGGACGTATCCACCCAGCAGGTGGTATCCGTCGGTGCGTCCCTGATCCCGTTCCTGGAACACGATGACGCCAACCGTGCATTGATGGGTGCGAACATGCAACGTCAGGCCGTTCCGACTCTGCGCGCTGATAAGCCGCTGGTTGGTACTGGTATGGAACGTGCTGTTGCCGTTGACTCCGGTGTAACTGCGGTAGCTAAACGTGGTGGTGTCGTTCAGTACGTGGATGCTTCCCGTATCGTTATCAAAGTTAACGAAGACGAGATGTATCCGGGTGAAGCAGGTATCGACATCTACAACCTGACCAAATACACCCGTTCTAACCAGAACACCTGTATCAACCAGATGCCGTGTGTGTCTCTGGGTGAACCGGTTGAACGTGGCGACGTGCTGGCAGACGGTCCGTCCACCGACCTCGGTGAACTGGCGCTTGGTCAGAACATGCGCGTAGCGTTCATGCCGTGGAATGGTTACAACTTCGAAGACTCCATCCTCGTATCCGAGCGTGTTGTTCAGGAAGACCGTTTCACCACCATCCACATTCAGGAACTGGCGTGTGTGTCCCGTGACACCAAGCTGGGTCCGGAAGAGATCACCGCTGACATCCCGAACGTGGGTGAAGCTGCGCTCTCCAAACTGGATGAATCCGGTATCGTTTACATTGGTGCGGAAGTGACCGGTGGCGACATTCTGGTTGGTAAGGTAACGCCGAAAGGTGAAACTCAGCTGACCCCAGAAGAAAAACTGCTGCGTGCGATCTTCGGTGAGAAAGCCTCTGACGTTAAAGACTCTTCTCTGCGCGTACCAAACGGTGTATCCGGTACGGTTATCGACGTTCAGGTCTTTACTCGCGATGGCGTAGAAAAAGACAAACGTGCGCTGGAAATCGAAGAAATGCAGCTCAAACAGGCGAAGAAAGACCTGTCTGAAGAACTGCAGATCCTCGAAGCGGGTCTGTTCAGCCGTATCCGTGCTGTGCTGGTAGCCGGTGGCGTTGAAGCTGAGAAGCTCGACAAACTGCCGCGCGATCGCTGGCTGGAGCTGGGCCTGACAGACGAAGAGAAACAAAATCAGCTGGAACAGCTGGCTGAGCAGTATGACGAACTGAAACACGAGTTCGAGAAGAAACTCGAAGCGAAACGCCGCAAAATCACCCAGGGCGACGATCTGGCACCGGGCGTGCTGAAGATTGTTAAGGTATATCTGGCGGTTAAACGCCGTATCCAGCCTGGTGACAAGATGGCAGGTCGTCACGGTAACAAGGGTGTAATTTCTAAGATCAACCCGATCGAAGATATGCCTTACGATGAAAACGGTACGCCGGTAGACATCGTACTGAACCCGCTGGGCGTACCGTCTCGTATGAACATCGGTCAGATCCTCGAAACCCACCTGGGTATGGCTGCGAAAGGTATCGGCGACAAGATCAACGCCATGCTGAAACAGCAGCAAGAAGTCGCGAAACTGCGCGAATTCATCCAGCGTGCGTACGATCTGGGCGCTGACGTTCGTCAGAAAGTTGACCTGAGTACCTTCAGCGATGAAGAAGTTATGCGTCTGGCTGAAAACCTGCGCAAAGGTATGCCAATCGCAACGCCGGTGTTCGACGGTGCGAAAGAAGCAGAAATTAAAGAGCTGCTGAAACTTGGCGACCTGCCGACTTCCGGTCAGATCCGCCTGTACGATGGTCGCACTGGTGAACAGTTCGAGCGTCCGGTAACCGTTGGTTACATGTACATGCTGAAACTGAACCACCTGGTCGACGACAAGATGCACGCGCGTTCCACCGGTTCTTACAGCCTGGTTACTCAGCAGCCGCTGGGTGGTAAGGCACAGTTCGGTGGTCAGCGTTTCGGGGAGATGGAAGTGTGGGCGCTGGAAGCATACGGCGCAGCATACACCCTGCAGGAAATGCTCACCGTTAAGTCTGATGACGTGAACGGTCGTACCAAGATGTATAAAAACATCGTGGACGGCAACCATCAGATGGAGCCGGGCATGCGAGAGTAGGGAACTGCCAGGCATCAAAGAAAACGAAAGGCACAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGGGAGCGGATTTGAACGTTGCGAAGCAACGGCCCGGAGGGTGGCGGGCAGGACGCCCGCCATAAACTGCCAGGCATCAAATTAAGCAGAAGGCCATCCTGACGGATGGCCTTTTTGCGTTTCTACAAACTCTTCCTGTCGTCATATCTACAAGCCATCCCCCCACAGATACGGTAAACTAGCCTCGTTTTTGCATCAGGAAAGCAGAAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCT 3'

Personal tools