Jessica Karen Wong/Notebook/2007-7-4

• Took out overnight plates of I2056 transformation and saw no more colonies
• PCR of I2055 also evaporated, redoing with 20ul and different tube
• Got I2057 sequence which matches registry

• Preped colonies 3, 4, and 6 of I2055 for sequencing
  • Minipreped and eluted with 30 ul pH 8.5 water instead of EB
  • used the 8-tubes, 2 samples of each colony, VR and VF
  • Mix: 2ul primer, x ul DNA to make b/t 200 and 500 ng, (10-x)ul water
  • Submitted order on dnalims.mit.edu
  • Building was locked so it's in the 4 degree

• Digested T9002 with Mfe1
  • used buffer 4 and 11 ul T9002

• Need scarring primers for I2056, I2057
  • I2056:
    • F: Same as I2055
    • R: same as I2055

• • I2057:
    • F: CTTAGTAG CAATTG TCACACAGGAAAGTACTAGATGGC (52.1)
    • R: same as I2055