Jessica Karen Wong/Notebook/2007-6-19

From OpenWetWare

Jump to: navigation, search

Ordered Primers for T9002

These will be used to PCR out T9002 in order to scar out the BB sites from a backbone plasmid.

  • T9002_F -- CTTAGTAG CAATTG TCCCTATCAGTGATAGAGATTGACATC
  • T9002_R -- TCAGCCAT ATGCAT TATAAACGCAGAAAGGCCCAC

Bold is the tail, italics is the restriction site.

Personal tools