IGEM:UNAM/2009/Notebook/Modeling logbook Claudia/2010/09/09

UNAM-Genomics-Mexico team

Main project page Previous entry      Next entry

Working on LovTAP.Reporter systems: PCR to fuse trpL promoter In order to construct the reporter system regulated by LovTAP, I and Zepeda are working together to fuse the promoter trpL with a reporter gene. As we are interested in characterize LovTAP activator and repressor activity. We have designed the following constructions. LovTAP repressor activity: Reporter system trpL promoter fused to GFP protein:Part:BBa_E0240 LovTAP activator activity: Reporter system trpL promoter fused to lambda Repressor cI: Part:BBa_P0451 + Part:BBa_K098991 regulating GFP protein:Part:BBa_E0240 Both constructions will be inserted in plasmid pSB3K3 for measurements. Experimental Setup 1.Insert the trpL promoter through a PCR reaction to the plasmid pSB1C3. -trpL promoter sequence tggcaaatattctgaaatgagctgttgacaattaatcatcgaactagttaactagtacgcAagttcacgtaaaaagggtat Primers designed: -Primer_trpL_reverse (5'->3'): SpeI site + trpL promoter + XbaI site + EcoRI site GGACTAGTCCCTTGCGTACTAGTTAACTAGTTCGATGATTAATTGTCAACAGCCTCTAGAAGCGGCCGCGAATTC -Primer forward (5'->3'): Suffix -Template: Plasmid pSB1C3 PCR taq platinum reaction mixture Reactive Quantity Buffer 10X PCR Buffer minus M 5μL 10mM dNTP mixture 1μL 50mM MgCl2 1.5μL Primer mix (10μΜ each) 1μL each Template DNA (plasmid pSB1C3) 1μL Platinum Taq DNA polymerase 0.2μL HPLC Up to a final volume of 50 μL of the mixture (39.3 μL) 35 PCR programmed cycles: The reaction starts at 95°C during 5 min. Each cycle is programmed as follows: Temperature Time 94°C 45s 55°C 45s 72°C 2:30 min After the cycle 35, the temperature changes to 72°C during 5 min and ends at 4°C. Results:PCR with promoter trpL Taq platinum PCR trpL+pSB1C3. Lane1:Ladder. Lane8: trpL+pSB1C3 Tm at 55° Replica 1. Lane9: trpL+pSB1C3 Tm at 55° Replica 2.The other lanes are samples from other experiments.Sample loaded 3μL.