IGEM:PennState/Labbook/GalenLynch/2007-7-23

From OpenWetWare

Jump to: navigation, search

Contents

July 23rd, 2007: 10:40 - 5:10

Sequencing Primers for biobricks in PSB1A2

TACTAGTAGC GGCCGCTGCA GGCTTCCTCG CTCACTGACT CGCTGCGCTC GGTCGTTCGG
CTGCGGCGAG CGGTATCAGC TCACTCAAAG GCGGTAATAC GGTTATCCAC AGAATCAGGG
GATAACGCAG GAAAGAACAT GTGAGCAAAA GGCCAGCAAA AGGCCAGGAA CCGTAAAAAG
GCCGCGTTGC TGGCGTTTTT CCATAGGCTC CGCCCCCCTG ACGAGCATCA CAAAAATCGA
CGCTCAAGTC AGAGGTGGCG AAACCCGACA GGACTATAAA GATACCAGGC GTTTCCCCCT
GGAAGCTCCC TCGTGCGCTC TCCTGTTCCG ACCCTGCCGC TTACCGGATA CCTGTCCGCC
TTTCTCCCTT CGGGAAGCGT GGCGCTTTCT CATAGCTCAC GCTGTAGGTA TCTCAGTTCG
GTGTAGGTCG TTCGCTCCAA GCTGGGCTGT GTGCACGAAC CCCCCGTTCA GCCCGACCGC
TGCGCCTTAT CCGGTAACTA TCGTCTTGAG TCCAACCCGG TAAGACACGA CTTATCGCCA
CTGGCAGCAG CCACTGGTAA CAGGATTAGC AGAGCGAGGT ATGTAGGCGG TGCTACAGAG
TTCTTGAAGT GGTGGCCTAA CTACGGCTAC ACTAGAAGGA CAGTATTTGG TATCTGCGCT
CTGCTGAAGC CAGTTACCTT CGGAAAAAGA GTTGGTAGCT CTTGATCCGG CAAACAAACC
ACCGCTGGTA GCGGTGGTTT TTTTGTTTGC AAGCAGCAGA TTACGCGCAG AAAAAAAGGA
TCTCAAGAAG ATCCTTTGAT CTTTTCTACG GGGTCTGACG CTCAGTGGAA CGAAAACTCA
CGTTAAGGGA TTTTGGTCAT GAGATTATCA AAAAGGATCT TCACCTAGAT CCTTTTAAAT
TAAAAATGAA GTTTTAAATC AATCTAAAGT ATATATGAGT AAACTTGGTC TGACAGTTAC
CAATGCTTAA TCAGTGAGGC ACCTATCTCA GCGATCTGTC TATTTCGTTC ATCCATAGTT
GCCTGACTCC CCGTCGTGTA GATAACTACG ATACGGGAGG GCTTACCATC TGGCCCCAGT
GCTGCAATGA TACCGCGAGA CCCACGCTCA CCGGCTCCAG ATTTATCAGC AATAAACCAG
CCAGCCGGAA GGGCCGAGCG CAGAAGTGGT CCTGCAACTT TATCCGCCTC CATCCAGTCT
ATTAATTGTT GCCGGGAAGC TAGAGTAAGT AGTTCGCCAG TTAATAGTTT GCGCAACGTT
GTTGCCATTG CTACAGGCAT CGTGGTGTCA CGCTCGTCGT TTGGTATGGC TTCATTCAGC
TCCGGTTCCC AACGATCAAG GCGAGTTACA TGATCCCCCA TGTTGTGCAA AAAAGCGGTT
AGCTCCTTCG GTCCTCCGAT CGTTGTCAGA AGTAAGTTGG CCGCAGTGTT ATCACTCATG
GTTATGGCAG CACTGCATAA TTCTCTTACT GTCATGCCAT CCGTAAGATG CTTTTCTGTG
ACTGGTGAGT ACTCAACCAA GTCATTCTGA GAATAGTGTA TGCGGCGACC GAGTTGCTCT
TGCCCGGCGT CAATACGGGA TAATACCGCG CCACATAGCA GAACTTTAAA AGTGCTCATC
ATTGGAAAAC GTTCTTCGGG GCGAAAACTC TCAAGGATCT TACCGCTGTT GAGATCCAGT
TCGATGTAAC CCACTCGTGC ACCCAACTGA TCTTCAGCAT CTTTTACTTT CACCAGCGTT
TCTGGGTGAG CAAAAACAGG AAGGCAAAAT GCCGCAAAAA AGGGAATAAG GGCGACACGG
AAATGTTGAA TACTCATACT CTTCCTTTTT CAATATTATT GAAGCATTTA TCAGGGTTAT
TGTCTCATGA GCGGATACAT ATTTGAATGT ATTTAGAAAA ATAAACAAAT AGGGGTTCCG
CGCACATTTC CCCGAAAAGT GCCACCTGAC GTCTAAGAAA CCATTATTAT CATGACATTA
ACCTATAAAA ATAGGCGTAT CACGAGGCAG AATTTCAGAT AAAAAAAATC CTTAGCTTTC
GCTAAGGATG ATTTCTGGAA TTCGCGGCCG CATCTAGAG

Primers:

Forward: GCTTTCGCTAAGGATGATTTCT
  • Mp: 60C
Reverse: TCAGTGAGCGAGGAAGC
  • Mp: 60C

Sequencing primers for biobrick of XylR

ATGTTTACTA AACGTCACCG CATCACATTA CTGTTCAATG CCAATAAAGC CTATGACCGG
CAGGTAGTAG AAGGCGTAGG GGAATATTTA CAGGCGTCAC AATCGGAATG GGATATTTTC
ATTGAAGAAG ATTTCCGCGC CCGCATTGAT AAAATCAAGG ACTGGTTAGG AGATGGCGTC
ATTGCCGACT TCGACGACAA ACAGATCGAG CAAGCGCTGG CTGATGTCGA CGTCCCCATT
GTTGGGGTTG GCGGCTCGTA TCACCTTGCA GAAAGTTACC CACCCGTTCA TTACATTGCC
ACCGATAACT ATGCGCTGGT TGAAAGCGCA TTTTTGCATT TAAAAGAGAA AGGCGTTAAC
CGCTTTGCTT TTTATGGTCT TCCGGAATCA AGCGGCAAAC GTTGGGCCAC TGAGCGCGAA
TATGCATTTC GTCAGCTTGT CGCCGAAGAA AAGTATCGCG GAGTGGTTTA TCAGGGGTTA
GAAACCGCGC CAGAGAACTG GCAACACGCG CAAAATCGGC TGGCAGACTG GCTACAAACG
CTACCACCGC AAACCGGGAT TATTGCCGTT ACTGACGCCC GAGCGCGGCA TATTCTGCAA
GTATGTGAAC ATCTACATAT TCCCGTACCG GAAAAATTAT GCGTGATTGG CATCGATAAC
GAAGAACTGA CCCGCTATCT GTCGCGTGTC GCCCTTTCTT CGGTCGCTCA GGGCGCGCGG
CAAATGGGCT ATCAGGCGGC AAAACTGTTG CATCGATTAT TAGATAAAGA AGAAATGCCG
CTACAGCGAA TTTTGGTCCC ACCAGTTCGC GTCATTGAAC GGCGCTCAAC AGATTATCGC
TCGCTGACCG ATCCCGCCGT TATTCAGGCC ATGCATTACA TTCGTAATCA CGCCTGTAAA
GGGATTAAAG TGGATCAGGT ACTGGATGCG GTCGGGATCT CGCGCTCCAA TCTTGAGAAG
CGTTTTAAAG AAGAGGTGGG TGAAACCATC CATGCCATGA TTCATGCCGA GAAGCTGGAG
AAAGCGCGCA GTCTGCTGAT TTCAACCACC TTGTCGATCA ATGAGATATC GCAAATGTGC
GGTTATCCAT CGCTGCAATA TTTCTACTCT GTTTTTAAAA AAGCATATGA CACGACGCCA
AAAGAGTATC GCGATGTAAA TAGCGAGGTC ATGTTGTAG

Primers:

Forward: ATGTTTACTAAACGTCACCGCATCA
  • Mp: 65C
Reverse: CTACAACATGACCTCGCTATTTACAT
  • Mp: 62C
Personal tools