IGEM:PennState/2007/Labbook/GarrettTobin/2007-8-6

From OpenWetWare

Jump to: navigation, search

August 8th

  • Designed Primers
  • Meeting @4
  • Started overnignt ligation of xylRORF into B0034
    • 12:30-6






xylR total 3732929..3734180

Extended for primers 3732860…3734210

TCGTTAAAGG TGCGATTCTG TTGCTGGCAG TATGGATGGA CTCCGCAACC AAACGCCGTT CTTGATTTTG ATAAAAATTT TCTCAAAGCC GGTTACGTAT TACCGGTTTT GAGTTTTTGC
ATGATTCAGC AGGAAAAGAA CCatgTTTAC TAAACGTCAC CGCATCACAT TACTGTTCAA TGCCAATAAA GCCTATGACC GGCAGGTAGT AGAAGGCGTA GGGGAATATT TACAGGCGTC 
ACAATCGGAA TGGGATATTT TCATTGAAGA AGATTTCCGC GCCCGCATTG ATAAAATCAA GGACTGGTTA GGAGATGGCG TCATTGCCGA CTTCGACGAC AAACAGATCG AGCAAGCGCT 
GGCTGATGTC GACGTCCCCA TTGTTGGGGT TGGCGGCTCG TATCACCTTG CAGAAAGTTA CCCACCCGTT CATTACATTG CCACCGATAA CTATGCGCTG GTTGAAAGCG CATTTTTGCA 
TTTAAAAGAG AAAGGCGTTA ACCGCTTTGC TTTTTATGGT CTTCCGGAAT CAAGCGGCAA ACGTTGGGCC ACTGAGCGCG AATATGCATT TCGTCAGCTT GTCGCCGAAG AAAAGTATCG 
CGGAGTGGTT TATCAGGGGT TAGAAACCGC GCCAGAGAAC TGGCAACACG CGCAAAATCG GCTGGCAGAC TGGCTACAAA CGCTACCACC GCAAACCGGG ATTATTGCCG TTACTGACGC 
CCGAGCGCGG CATATTCTGC AAGTATGTGA ACATCTACAT ATTCCCGTAC CGGAAAAATT ATGCGTGATT GGCATCGATA ACGAAGAACT GACCCGCTAT CTGTCGCGTG TCGCCCTTTC 
TTCGGTCGCT CAGGGCGCGC GGCAAATGGG CTATCAGGCG GCAAAACTGT TGCATCGATT ATTAGATAAA GAAGAAATGC CGCTACAGCG AATTTTGGTC CCACCAGTTC GCGTCATTGA 
ACGGCGCTCA ACAGATTATC GCTCGCTGAC CGATCCCGCC GTTATTCAGG CCATGCATTA CATTCGTAAT CACGCCTGTA AAGGGATTAA AGTGGATCAG GTACTGGATG CGGTCGGGAT 
CTCGCGCTCC AATCTTGAGA AGCGTTTTAA AGAAGAGGTG GGTGAAACCA TCCATGCCAT GATTCATGCC GAGAAGCTGG AGAAAGCGCG CAGTCTGCTG ATTTCAACCA CCTTGTCGAT 
CAATGAGATA TCGCAAATGT GCGGTTATCC ATCGCTGCAA TATTTCTACT CTGTTTTTAA AAAAGCATAT GACACGACGC CAAAAGAGTA TCGCGATGTA AATAGCGAGG TCATGTTGTA 
GCGATGATGA GAATTGTCGG CGTCACATCA G 



Primers



TOTAL: Front Gaattcgcggccgcttctagag TCGTTAAAGG TGCGATTCTG

End AATTGTCGG CGTCACATCAG tactagtagcggccgctgcag Reverse complement cagcggccgctactag CTGATGTGACGCCGACAATT


Primers for sequencing:

1/3 through xylR ORF

  • Forward: GCCACTGAGCGCGAATATGC Tm=66
  • Reverse: GCATATTCGCGCTCAGTGGC

2/3 through xylR ORF

  • Forward: CACCAGTTCGCGTCATTGAACGG Tm=68
  • Reverse: CCGTTCAATGACGCGAACTGGTG


order # 1131

Personal tools