IGEM:Peking/2007/Count-Conjugation-Notebook/2007-7-9

From OpenWetWare

Jump to: navigation, search

Contents

Order the <bbpart>pSB1A2</bbpart> sequencing primer

  • vf2: tgccacctgacgtctaagaa
  • vr: attaccgcctttgagtgag

Order the <bbpart>BBa_J23078</bbpart> synthesizing primer

  • We want to synthesize J23078 with a NotI-XbaI prefix and SpeI suffix:

cggccgcttctagagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcact actagagtgtagaccgaactagaatcacctcttgcttttgggtaagacagaagaggagatactag

  • We order two primer overlapping by 13 bp:

>igempku-crRNA-J23078-primer1
cggccgcttctagagtgtagaccgaactagaatcacctcttgcttttggg
>igempku-crRNA-J23078-primer2
actagtatctcctcttctgtcttacccaaaagcaagaggtgattctagt

E.coli strains fetched from CGMCC

  • 3 strains containing F, R751, pSC101 plasmids
  • CGMCC accession: 1.1137 -> pSC101; 1.1501 -> R751; 1.747 -〉F
  • Culture media included
  • fetched by Yu Tao

Knockout primer design

  • Xu Anting
    • Designed 6 pairs of primers to delete oriT by homologous recombination
Plasmid F: oriT at 66118..66407
Product_F1: 592 bp
F1_sense (BamHI): 5'- cgcGGATCCCTGCACGCTGTTAATTTCC -3' (Length=28, Tm=77.8, GC%=57.1)
F1_anti: 5'- agtctgacatcgAAGCTTccagctagactgTTTTGTGGAGTGGGTTAAATT -3' (Length=51, Tm=84.3, GC%=43.1)
Product_F2: 596 bp
F2_sense: 5'- cagtctagctggAAGCTTcgatgtcagactTCCCTGTTTGCATTATGA -3' (Length=48, Tm=84.8, GC%=45.8)
F2_anti (BamHI): cgcGGATCCTTAACGTGGCATTAACCA -3' (Length=27, Tm=74.2, GC%=51.9)
Plasmid R751: oriT at 51526..51624
Product_R751_1: 620 bp
R1_sense (BamHI): 5'- cgcGGATCCTTTGGGCGTCGGTGATGTAG -3' (Length=29, Tm=80.7, GC%=62.1)
R1_anti: 5'- agtctgacatcgAAGCTTccagctagactgACTGTCCCTTATTCGCGC -3' (Length=48, Tm=86.8, GC%=52.1)
Product_R751_2: 628 bp
R2_sense: 5'- cagtctagctggAAGCTTcgatgtcagactCACCAGCCATTACGATTTAT -3' (Length=50, Tm=84.8, GC%=46.0)
R2_anti (SalI): acgcGTCGACCCTCTTTCTTTGGAGTCGC -3' (Length=29, Tm=78.1, GC%=58.6)
Plasmid pSC101: oriT at 4071..4115
Product_pSC101_1: 619 bp
S1_sense (BamHI): 5'- cgcGGATCCGTGCTTATTCTGGAGGTCAGC -3' (Length=30, Tm=79.5, GC%=60.0)
S1_anti: 5'- agtctgacatcgAAGCTTccagctagactgTTCAGCGGGATAAAACAC -3' (Length=48, Tm=86.8, GC%=52.1)
Product_R751_2: 601 bp
R2_sense: 5'- cagtctagctggAAGCTTcgatgtcagactCCTGATAAATAAAAGAGTTATC -3' (Length=52, Tm=80.7, GC%=40.4)
R2_anti (SalI): acgcGTCGACGGTGCTATCTGACTTTTTGC -3' (Length=30, Tm=77.0, GC%=53.3)
  • Xu Anting and Ma Tao
    • Read:;
Lanka, E. & Wilkins, B. (1995).
DNA Processing in Bacterial Conjugation.
Annual Rev Biochem, 64, 141-69.
Personal tools