IGEM:Paris Bettencourt 2012/Notebooks/Semantic group/annexe

From OpenWetWare

Jump to: navigation, search
Notebook Design Roadmap Meetings and to-dos Protocols Bibliography Previous Biosafety iGEM projects


Semantic containment project

Annexes


Contents

Sequences

Prefix 1

Before sequences starting with ATG GAATTCGCGGCCGCTTCTAG

Prefix 2

Before sequences starting with no ATG GAATTCGCGGCCGCTTCTAGAG

Suffix

TACTAGTAGCGGCCGCTGCAG

Plasmid 1 : pSB3C5::S0/1/6


NB :

  • P- & -S means Prefix and Suffix added


Geneious file : Image:Semantic.geneious (right click, save under...)

P-KanR all serines changed-S

 GAATTCGCGGCCGCTTCTAGATGTAGCATATTCAACGGGAAACGTAGTGC
 TAGAGGCCGCGATTAAATTAGAACATGGATGCTGATTTATATGGGTATAA
 ATGGGCTCGCGATAATGTCGGGCAATAGGGTGCGACAATCTATCGATTGT
 ATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTTAG
 GTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGA
 ATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATG
 CATGGTTACTCACCACTGCGATCCCCGGGAAAACAGCATTCCAGGTATTA
 GAAGAATATCCTGATTAGGGTGAAAATATTGTTGATGCGCTGGCAGTGTT
 CCTGCGCCGGTTGCATTAGATTCCTGTTTGTAATTGTCCTTTTAACTAGG
 ATCGCGTATTTCGTCTCGCTCAGGCGCAATAGCGAATGAATAACGGTTTG
 GTTGATGCGTAGGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACA
 AGTCTGGAAAGAAATGCATAAGCTTTTGCCATTCTAGCCGGATTAGGTCG
 TCACTCATGGTGATTTCTAGCTTGATAACCTTATTTTTGACGAGGGGAAA
 TTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCA
 GGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTAGCCTTAGTTAC
 AGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATAAA
 TTGCAGTTTCATTTGATGCTCGATGAGTTTTTCTAATACTAGTAGCGGCC
 GCTGCAG

Fragment 1

 GAATTCGCGGCCGCTTCTAGATGTAGCATATTCAACGGGAAACGTAGTGC
 TAGAGGCCGCGATTAAATTAGAACATGGATGCTGATTTATATGGGTATAA
 ATGGGCTCGCGATAATGTCGGGCAATAGGGTGCGACAATCTATCGATTGT
 ATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTTAG
 GTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGA
 ATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATG
 CATGGTTACTCACCACTGCGATCCCCGGGAAAACAGCATTCCAGGTATTA
 GAAGAATATCCTGATTAGGGTGAAAATATTGTTGATGCGCTGGCAGTGTT
 CCTGCGCCGGTTGCATTAGATTCCTGTTTGTAATTGTCCTTTTAACTAGG
 ATCGCGTATTTCGTCTCGCTCAGGCGCAATAGCGAATGAATAACG

Fragment 2

 GATTAGGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTT
 GCATTAGATTCCTGTTTGTAATTGTCCTTTTAACTAGGATCGCGTATTTC
 GTCTCGCTCAGGCGCAATAGCGAATGAATAACGGTTTGGTTGATGCGTAG
 GATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGA
 AATGCATAAGCTTTTGCCATTCTAGCCGGATTAGGTCGTCACTCATGGTG
 ATTTCTAGCTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGT
 ATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCAT
 CCTATGGAACTGCCTCGGTGAGTTTTAGCCTTAGTTACAGAAACGGCTTT
 TTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTGCAGTTTCAT
 TTGATGCTCGATGAGTTTTTCTAATACTAGTAGCGGCCGCTGCAG

Plasmid 2 : pSB1A3::supD_T1

BBa_K228001 - SupD-tRNA

 CAATTCGGAGAGATGCCGGAGCGGCTGAACGGACCGGTCTCTAAAACCGG
 AGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCGCCACTAC
 AGATCCTTAGCGAAAGCTAAGGATTTTTTTTAAGCT

BBa_B1006 - Terminator 1

AAAAAAAAACCCCGCCCCTGACAGGGCGGGGTTTTTTTT

Scripts

Personal tools