IGEM:MIT/2007/Notebook/2007-6-25

From OpenWetWare

Jump to: navigation, search

Contents

To-Do

  1. Sequence inserts OmpC, CPX, with polystyrene-binding (17, 18) and polypyrrole-binding peptides
  2. Check sequences
  3. Get grads to check sequences
  4. Ask about UCSB eCPX

DNA Sequences

NOTE: it would be better if we could order these as oligos and stitch them together rather than ordering a huge protein and waiting a month.

CPX with polystyrene (18) binding peptide as passenger peptide)

Random bp and XbaI (TCTAGA):

1   CATTAGTCTA GA
OmpX Native signal sequence:

13    ATGAAAAA AATTGCATGT CTTTCAGCAC 
41  TGGCCGCAGT TCTGGCTTTC ACCGCAGGTA 
71  CTTCCGTAGC T
Linker Sequence, GGCCNNNNNGGCC SfiI Restriction Site:

82   GGCCAGTCT GGCCAG
His6 Tag:

97        CATC ACCATCACCA TCAC
Trypsin Cleavage Site:

115     AAACGT
HindIII:

121 AAGCTT
Polystyrene-binding Peptide 18:

127       TTCT TCTCTTTCTT CTTCCCGGCT 
151 TCTGCTTGGG GTTCT
SalI:

166      GTCGA C 
Linker with embedded SfiI:

172  GGTGGCCAA TCAGGCCAG
OmpX S54-F148:

189          T CTGGTGACTA CAACAAAAAC 
211 CAGTACTACG GCATCACTGC TGGTCCGGCT
241 TACCGCATTA ACGACTGGGC AAGCATCTAC
271 GGTGTAGTGG GTGTGGGTTA TGGTAAATTC
301 CAGACCACTG AATACCCGAC CTACAAACAC
331 GACACCAGCG ACTACGGTTT CTCCTACGGT
361 GCGGGTCTGC AGTTCAACCC GATGGAAAAC
391 GTTGCTCTGG ACTTCTCTTA CGAGCAGAGC 
421 CGTATTCGTA GCGTTGACGT AGGCACCTGG 
451 ATTGCCGGTG TTGGTTACCG CTTC
Linker for OmpX C & N Terminus:

475     GGTGGT TCTGGT 
OmpX A1-S53:

487       GCGA CTTCTACTGT AACTGGCGGT 
511 TACGCACAGA GCGACGCTCA GGGCCAAATG 
541 AACAAAATGG GCGGTTTCAA CCTGAAATAC 
571 CGCTATGAAG AAGACAACAG CCCGCTGGGT 
601 GTGATCGGTT CTTTCACTTA CACCGAGAAA 
631 AGCCGTACTG CAAGC
Stop Codons

646      TAGTA G
EcoRI (GAATTC) and Random bps:

652  GAATTCCAT TAG

OmpC with polystyrene (18) binding peptide as passenger peptide)

Random bps and BamHI (GGATCC):

1    CATTAGGGAT CC
Front Half of OmpC

13     ATGAAAGT TAAAGTTCTG TCTCTGCTGG 
41   TTCCGGCTCT GCTGGTTGCT GGTGCTGCTA 
71   ACGCTGCTGA AGTTTACAAC AAAGACGGTA 
101  ACAAACTGGA CCTGTACGGT AAAGTTGACG 
131  GTCTGCACTA CTTCTCTGAC GACAAATCTG 
161  TTGACGGTGA CCAGACCTAC ATGCGTCTGG 
191  GTTTCAAAGG TGAAACCCAG GTTACCGACC 
221  AGCTGACCGG TTACGGTCAG TGGGAATACC 
251  AGATCCAGGG TAACTCTGCT GAAAACGAAA 
281  ACAACTCTTG GACCCGTGTT GCTTTCGCTG 
311  GTCTGAAATT CCAGGACGTT GGTTCTTTCG 
341  ACTACGGTCG TAACTACGGT GTTGTTTACG 
371  ACGTTACCTC TTGGACCGAC GTTCTGCCGG 
401  AGTTCGGTGG TGACACCTAC GGTTCTGACA 
431  ACTTCATGCA GCAGCGTGGT AACGGTTTCG 
461  CTACCTACCG TAACACCGAC TTCTTCGGTC 
491  TGGTTGACGG TCTGAACTTC GCTGTTCAGT 
521  ACCAGGGTAA AAACGGTTCT GTTTCTGGTG 
551  AAGGTATGAC CAACAACGGT CGTGAAGCTC 
581  TGCGTCAGAA CGGTGACGGT GTTGGTGGTT 
611  CTATCACCTA CGACTACGAA GGTTTCGGTA 
641  TCGGTGCTGC TGTTTCTTCT TCTAAACGTA 
671  CCGACGACCA GAACTCTCCG CTGTACATCG 
701  GTAACGGTGA CCGTGCTGAA ACCTACACCG 
731  GTGGTCTGAA ATACGACGCT AACAACATCT 
761  ACCTGGCTGC TCAGTACACC CAGACCTACA 
791  ACGCTACCCG TGTTGGTTCT CTGGGTTGGG 
821  CTAACAAAGC TCAGAACTTC GAAGCTGTTG 
851  CTCAGTACCA GTTCGACTTC GGTCTGCGTC 
881  CGTCTCTGGC TTACCTGCAG
His6 Tag:

901  CATCACCATC ACCATCAC 
Trypsin Cleavage site:

919          AA ACGT 
ggsg AA linker:

925      GGTGGT TCTGGT 
HindIII:

937        AAGC TT 
Polystyrene-binding peptide (18):

943    TTCTTCTC TTTCTTCTTC CCGGCTTCTG 
971  CTTGGGGTTC T 
SalI:

982   GTCGAC 
Back Half of OmpC:

988         TCT AAAGGTAAAA ACCTGGGTGT
1011 TATCAACGGT CGTAACTACG ACGACGAAGA 
1041 CATCCTGAAA TACGTTGACG TTGGTGCTAC
1071 CTACTACTTC AACAAAAACA TGTCTACCTA 
1101 CGTTGACTAC AAAATCAACC TGCTGGACGA 
1131 CAACCAGTTC ACCCGTGACG CTGGTATCAA
1161 CACCGACAAC ATCGTTGCTC TGGGTCTGGT
1191 TTACCAGTTC
Stop Codons:

1201 TAGTAG 
XbaI (TCTAGA) and Random bps:

1207       TCTA GACATTAG

Passenger Peptide Oligos w/ Restriction Cuts Built In

Sense/Coding strand: 5'- HindIII cut + Peptide + SalI cut -3'

Polystyrene-binding peptide 18:

5’ AGCTT tttttttctttcttcttcccggcttctgcttggggttct G 3’
3’     A                                         CAGCT 5’

Reverse of anti-sense/non-coding strand:
5’ TCGAC agaaccccaagcagaagccgggaagaagaaagaaaaaaa A 3’ 

Polystyrene-binding peptide 17:

Sense:
5’ AGCTT ttcttcccgtcttcttggtactctcacctgggtgttctg G

Anti-sense:
5’ TCGAC cagaacacccaggtgagagtaccaagaagacgggaagaa A 

Polypyrrole-binding peptide:

Sense:
5’ AGCTT acccaccgtacctctaccctggactacttcgttatc G

Anti-sense:
5’ TCGAC gataacgaagtagtccagggtagaggtacggtgggt A

USING SEQUENCHER (Demo)

  • Copy desired gene sequence (to check)
  • Sequence tab
    • Create New Sequence
    • Give name
    • Paste sequence
  • View tab
    • Translation – different reading frames (gives AAs)
    • Fifth button over – check presence of all common enzyme sites
  • Cut map tab – show where different restriction sites
    • Select enzymes – look for different enzymes and click ok to see where that site is (Ensure presence/absence of restriction enzymes)
    • Bases
  • View tab
    • Reverse and Com – gives reverse complementary sequence
    • Can look at sequencing data (ambiguities?)
  • Take whole sequence (front, middle, back) and ensure all restriction enzymes are correct and present
Personal tools