IGEM:MIT/2006/Notebook/2006-8-8

From OpenWetWare

Jump to: navigation, search

Contents

General Notes

  • remove plain A/T plates from 37 room (checking for plate contamination) -done
  • run a gel of pchBA/etc. -done
  • topo PCR THI3
  • digest BAT@ with XP, 3 part assemble RBS-BAT2
  • transform
  • BC 18:57, 7 August 2006 (EDT): I recommend you try both with the "freeze" step (nice name!) and without it as some people don't find this to be a helpful reaction.
  • received an agar stab of DH5alpha E. coli cells with the pUCP22 pseudomonas shuttle vector in it. Plated/streaked to recover cells on an Amp plate today. This is cool news

LCs

  • LC all colonies in A/T LB
  • LC 1-3 and 9,10 in A/T LB supplemented with correct concentration of Isoamyl Alcohol (check with Veena for concentration/volume)
  • LC 4-8 and 11-15 in A/T LB supplemented with 300-350 μM Salicylic Acid (40 μL in 10 mL LC)
    • FINALLY...SOME SMELL TESTS to be conducted tomorrow am!!!

Competent Indole KO Strain

  • Transform with R0040.RBS.BSMT.B0015 (J45100 for B0030 and J45102 for B0032),
  • Transform with R0040.RBS.ATF1-1148.B0015
  • Transform with J45993.RBS.BSMT.B0015
  • Transform with J45993.RBS.ATF1-1148.B0015
    • Ligations from 8/7 are saved in our freezer in a tip box!!

IAGD

  • Cut BAT2 with XP
    • 3 part assemble with B0030:ES and A/T:EP
    • 3 part assemble with B0032:ES and A/T:EP

Transformations

  1. 6 IK A/T plates (8/7 ligation mixes 2, 3, 4, 5, 7, 8)
  2. 2 RBS-BAT2 3-part A/T assemblies (using 30 and 32)
  3. 2 THI3 topos (using old and new pcr product)
  4. 2 osmY-E0840 3-part A/T assemblies (using reg. cut E0840 and Gel extracted version)
  5. 2 puc18 controls (using Top10 cells and IK cells)

New THI3-mut primers

  • ordered primer pair 1, without the first C because it contributed to a hairpin

Primer pair 1

                                 *
   Forward: 5' CATCGTAGATGCATGTACCAGTCGACAGAATTTAATC 3'
   Reverse: 5' GATTAAATTCTGTCGACTGGTACATGCATCTACGATG 3'
                                 *
    GC content: 40.54%           Location: 5-41
    Melting temp: 77.1°C         Mismatched bases: 1
    Length: 37 bp                Mutation: Substitution
    5' flanking region: 18 bp    Forward primer MW: 11356.53 Da
    3' flanking region: 18 bp    Reverse primer MW: 11378.53 Da

Primer pair 2

                                 *
   Forward: 5' CATCGTAGATGCATGTACCAGTCGACAGAATTTAATCG 3'
   Reverse: 5' CGATTAAATTCTGTCGACTGGTACATGCATCTACGATG 3'
                                  *
    GC content: 42.11%           Location: 5-42
    Melting temp: 78.0°C         Mismatched bases: 1
    Length: 38 bp                Mutation: Substitution
    5' flanking region: 18 bp    Forward primer MW: 11685.74 Da
    3' flanking region: 19 bp    Reverse primer MW: 11667.72 Da
Personal tools