IGEM:IMPERIAL/2006/project/Oscillator/luxRtag
From OpenWetWare
Tagging LuxR
We may need to mseure the LuxR concentration in our system. I propose that the most accurate way is to use an ELISA assay. Our system already has aiiA tagged with a FLAG tag (DYKDDDDKG) So we need to use a different tag, such as HA (YPYDVPDYA.) There are [EMSA kits] avalible for both tags.
DNA Sequence
YPYDVPDYA is the amino acid sequence of the tag so that must be converted to a DNA sequence. I used the codon usage database from NCBI to pick commonly used codons in E.coli so the protein can be made by the cells efficiantly. the DNA code should be TATCCGTATGATGTGCCGGATTATGCA
How to add this sequence
There are 2 methods of adding the tag to LuxR, both will probably take around a week. They are PCR and Ligation I would suggest that we do both in parrallel
Ligation
We cannot ligate as the luxR gene has a stop codon at the end so simply ligating the tag onto the end won't mean it will be expressed
PCR
- Stop Codons


