IGEM:Harvard/2006/DNA nanostructures/Notebook/2006-8-25
From OpenWetWare
< IGEM:Harvard | 2006 | DNA nanostructures | Notebook
Contents |
PEG fractionation
- Goal: to get cleaner purification of oligos away from nanostructures and to increase the volume of purified nanostructures we have for protection assays. Given the results of 8-23 I'm working with a new batch of folded design 5 and trying to see if the double bands and trouble moving through the gel were simply artifacts of that particular folding or if they are larger problems that need to be addressed.
- Nanostructures:
- using 30mM MgCl2, 1x oligos (seems to work best given previous results).
- designs: c5.0.A, c5.0.C, c5.0.D
- PEG: 8%, 10%. Total volume in each is 100 μL
- 8 % Cocktail:
40 μL 20% PEG
10 μL 5M NaCl
10 μL water
40 μL Nanostructures (add last)
- 10 % Cocktail:
50 μL 20% PEG
10 μL 5M NaCl
40 μL Nanostructures (add last)
- incubate on ice for 15 min.
- spin at 16 k rcf at 4[[:Category:{{{1}}}|{{{1}}}]] for 10 min.
- carefully pipette off supernatant
- resuspended "pellet" in 1x folding buffer. for now, resuspend in original total volume (100 μL but may resuspend in less in the future to improve protection assay results)
- note: add PEG first, nanostructures last; mix using tapping after everything added. let sit for ~5 min. before putting it on ice
| Lane | contents |
| gel1-1 | ladder |
| gel1-2 | scaffold |
| gel1-3 | 5.0.A unpurified |
| gel1-4 | 5.0.A 8% pellet 1 |
| gel1-5 | 5.0.A 8% supernatant 1 |
| gel1-6 | 5.0.A 8% pellet 2 |
| gel1-7 | 5.0.A 8% supernatant 2 |
| gel1-8 | 5.0.A 10% pellet 1 |
| gel1-9 | 5.0.A 10% supernatant 1 |
| gel1-10 | 5.0.A 10% pellet 2 |
| gel1-11 | 5.0.A 10% supernatant 2 |
| gel1-12 | 5.0.C unpurified |
| gel1-13 | 5.0.C 8% pellet 1 |
| gel1-14 | 5.0.C 8% supernatant 1 |
| gel1-15 | 5.0.C 8% pellet 2 |
| gel1-16 | 5.0.C 8% supernatant 2 |
| gel1-17 | 5.0.C 10% pellet 1 |
| gel1-18 | 5.0.C 10% supernatant 1 |
| gel1-19 | 5.0.C 10% pellet 2 |
| gel1-20 | 5.0.C 10% supernatant 2 |
| gel2-1 | ladder |
| gel2-2 | 5.0.D unpurified |
| gel2-3 | 5.0.D 8% pellet 1 |
| gel2-4 | 5.0.D 8% supernatant 1 |
| gel2-5 | 5.0.D 8% pellet 2 |
| gel2-6 | 5.0.D 8% supernatant 2 |
| gel2-7 | 5.0.D 10% pellet 1 |
| gel2-8 | 5.0.D 10% supernatant 1 |
| gel2-9 | 5.0.D 10% pellet 2 |
| gel2-10 | 5.0.D 10% supernatant 2 |
Streptavidin Bead Depletion: Investigation of Fb
Strep Treatment Protocol
- Same as that done Wednesday, only with just the c5.0.A and c5.0.Fb folded yesterday, and the c5.0.Fb folded by Katie on 8.22.
- Other modification: everything was rediluted up to 35uL instead of 40uL in 30mM 1x folding buffer.
Gel
- NB: Accidentally ran old-folded Fb before new-folded Fb in the untreated trial. New-folded Fb was loaded into the gel before old-folded Fb in every other trial. The mistake is noted in bold in the table below.
- NB: Gel wells seemed to hold somewhat less material than previously - thus, though the samples were only diluted up to 35uL instead of 40uL this time, only about 30uL of the 37 (35uL of sample + 2uL dye), or 80% of the material made it into the wells.
- 2% agarose, 0.5xTBE supplemented to 10mM MgCl2; 5uL EtBr
- run @ 100V for 1hr in 0.5xTBE supplemented to 10mM MgCl2
- 2uL 10x TBE/glycerol loading dye for each well
| Lane | Component | Test Condition | Amount |
| 1 | 1kb+ ladder | - | 10uL |
| 2 | p7308 (~42nM) | - | 9uL |
| 3 | c5.0.A barrel (lidless) | Untreated | 10uL |
| 4 | c5.0.Fb inside biotinylated barrel (folded 8.22) | Untreated | 10uL |
| 5 | c5.0.Fb inside biotinylated barrel (folded 8.24) | Untreated | 10uL |
| 6 | barrel (lidless) | Beaded | ~30uL |
| 7 | inside biotinylated barrel (folded 8.24) | Beaded | ~30uL |
| 8 | inside biotinylated barrel (folded 8.22) | Beaded | ~30uL |
| 9 | barrel (lidless) | Free-strep | ~30uL |
| 10 | inside biotinylated barrel (folded 8.24) | Free-strep | ~30uL |
| 11 | inside biotinylated barrel (folded 8.22) | Free-strep | ~30uL |
| 12 | barrel (lidless) | Free, bead | ~30uL |
| 13 | inside biotinylated barrel (folded 8.24) | Free, bead | ~30uL |
| 14 | inside biotinylated barrel (folded 8.22) | Free, bead | ~30uL |
Results
- Though it seems that the 8.24 Fb may be better folded than the 8.22 Fb, as seen by the decreased amount of streaking and material trapped in the well in lane 5 as opposed to lane 4, the 8.24 Fb is still taken up by the streptavidin beads (no band in lane 8). This indicates either:
- 1. There is some misfolding property of Fb that exposes the inside environment of the barrel to the outside environment of the beaded environment.
- This would suggest steps to ascertain reasons for this misfolding:
- Looking at the pre-working stocks that differ from Eb
- Analyzing the sequences of the oligos involved to make sure that there were no mistakes made
- Remixing the pre-working stocks involved, in case the wrong wells in the plates were used in making these originally
- Remixing Fb
- This would suggest steps to ascertain reasons for this misfolding:
- 2. Streptavidin, though bound to beads, can still reach far enough into the barrel to bind (and thus remove from the supernatant) inside biotin.
- This is possible. As detailed earlier, the dimensions of the streptavidin molecule (in conjunction with the lack of detail about where on the streptavidin molecule is linked to the bead in relation to the biotin-binding site) could technically allow it to reach the biotins, which are hanging off the side of the barrel by 3 Ts, or (3*0.34nm =) roughly 1nm. This is in addition to the actual length of the biotin molecule, if the binding can be said to start at one end of the molecule.
- Some of the inside biotinylated sites are only 3 7bp-sub-tokens away from the edge of the barrel, or (21*0.34nm=) 7.14nm.
- If the 4-carbon linker, roughly 0.4nm in length, and this above information is taken into consideration, the streptavidin molecule could reach into the barrel roughly 4.8nm+0.4nm conservatively, 5.8+0.4nm at most. And the 3T-linker of 1nm and the length of the biotin molecule itself could conceivably give enough leeway for the streptavidin to bind internal sites.
- If this is the case, we can order biotinylated oligos which exit the barrel closer to the middle of the barrel.
- But before we take this step, we should try to ascertain whether this is actually the problem, as opposed to possibilities (1) or (3).
- (Or we could wait till we get lids actually on the c5.0 barrel and try again - but this would assume that we'll be able to get the lids folded, attached correctly, and done before November. It seems like a bad idea to wait.)
- 3. The biotins, though we designed them point out to the inside of the barrel (and we're certain that the aptamer sites were technically on the inside, as this is a double-ply barrel), they might be pushing out through the double-ply width of the barrel through holes between helices.
- Because this is a double-ply barrel, this seems reasonably unlikely, but it is a possibility.
- 1. There is some misfolding property of Fb that exposes the inside environment of the barrel to the outside environment of the beaded environment.
- Also, for some unknown reason, old-folded Fb runs slower than new-folded Fb, which runs faster than A. Technically, they should all run at the same speed - this might indicate that there is significant misfolding, to change the "aerodynamism" of the structure by this much.
- The untreated c5.0.A barrel seems significantly brighter than the beaded c5.0.A. This most likely does not indicate that the beads bind a great deal of material non-specifically, but instead that the inability to load all of the material along with loss in the pelleting and pipetting processes might have reduced yield. This is borne up by the equivalently dim bands in the free-streptavidinated and free-then-beaded lanes for c5.0.A.
Discovery of Mistake in Biotinylated Oligos
- Biotinylated oligos for c.5.0 were just ordered as the c5.0.4 and c5.0.5 "barrel oligos @ _______-facing aptamer sites -aptamers" with biotins added to their 3' ends.
- Unfortunately, the inside-aptamer sites are NOT on the 3' ends of most of these oligos, as can be seen in the 2D schematic. I am also reasonably sure that these oligos on the schematic correspond to those in the table - the lengths match up.
- Thus, we must order new biotinylated oligos:
| c5.0.8revised (split; "a" and "b" denote split, for use with the c5.0.4.# with the other letter) | ' | ' |
| oligo 7 | c5.0.8.1ra | ATAAATC GTGTTGT TCCAGTT -biotin |
| oligo 7 | c5.0.8.1rb | TGGAACAAGAGTCCGTAAAGC |
| oligo 43 | c5.0.8.2ra | GCCGGAA GCAGGTC GACTCTA AGGGGGA -biotin |
| oligo 43 | c5.0.8.2rb | TGTGCTGCGGAAAC |
| oligo 65 | c5.0.8.3r | TCATTTT TTTACAA ACAATTC AAATGAA AAATCTA GATAAAA-biotin (don't need to order - same as c5.0.8.3) |
| oligo 75 | c5.0.8.4r | ATCAATA GATAAAA ATTTTTA GAACCCT CATATAT ATTAGCA-biotin (don't need to order - same as c5.0.8.4) |
| oligo 78 | c5.0.8.5ra | GGTATTA AATATCC CATCCTA -biotin |
| oligo 78 | c5.0.8.5rb | ATTTACGAGCATGTCGAGCCA |
| c5.0.9revised (split; "a" and "b" denote split, for use with the c5.0.5.# with the other letter) | ||
| oligo 33 | c5.0.9.1ra | GCCGCCA TTGATAT TCACAAA -biotin |
| oligo 33 | c5.0.9.1rb | CAAATAAATCCTCATCTGAAT |
| oligo 67 | c5.0.9.2ra | ATTTACA TTTTGCG GGATCGT GAAGTTT CCATTAA -biotin |
| oligo 67 | c5.0.9.2rb | ACGGGTA (don't need to order) |
| oligo 89 | c5.0.9.3ra | TGGATAG CGATAAA AACCAAA -biotin |
| oligo 89 | c5.0.9.3rb | ATAGCGAGAGGCTTACAACAT |
| oligo 95 | c5.0.9.4ra | AAAGAAA AATGAAT TTTCTGT TCACCAG TACAAAC -biotin |
| oligo 95 | c5.0.9.4rb | TACAACG (don't need to order) |
| oligo 104 | c5.0.9.5ra | TCATTTG TTCTGCG -biotin |
| oligo 104 | c5.0.9.5rb | AACGAGTGGTCATTTTTGCGGACCAGAC |
- Request was sent to Alain Sat 12:30AM in an email. He will order early Saturday morning.
- NB: Happily, the attachment-oligos for c5.0 WERE split correctly.


