Harvard:Biophysics 101/Notebook:ZS/2007-4-26
From OpenWetWare
Tackling the problem of finding information about ref seq
Xiaodi and Katie have been working on this, but had trouble parsing a blast result becuase (as I painfully found out) the XML returns nothing useful, and before one could not get back the HTML which blast returns. I found the snippit to get the HTML version, which I then raw-parsed for the relevant information. Then, this preliminarily determines surrounding genes of interest and if it hits any known CDS's. The code needs cleaned, but its a proof of principle :D. The data can then be fed to other entrez programs.
Code
#Zachary Sun, Biophysics 101
#4.26.07 code
#Tackling the problem of finding surrounding CDS's and information about a reference sequence from blast,
#this program parses the HTML output of blastn as of 4.26.07 for information which can then be fed
#into other NCBI programs to be programmed,
#Saves a local file; to stop queuing the web, just comment the code with pound symbols at end.
from Bio import SeqIO
from Bio.Blast import NCBIWWW
from Bio.Blast import NCBIXML
import xml.sax.handler
from xml.dom import minidom
#class seq on first line, other CDS seq on second
#seq = "CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACGCATGCCACCCACAACAACTTTTTAAAAGAATCAGACGTGTGAAGGATTCTATTCGAATTACTTCTGCTCTCTGCTTTTATCACTTCACTGTGGGTCTGGGCGCGGGCTTTCTGCCAGCTCCGCGGACGCTGCCTTCGTCCRGCCGCAGAGGCCCCGCGGTCAGGGTCCCGCGTGCGGGGTACCGGGGGCAGAACCAGCGCGTGACCGGGGTCCGCGGTGCCGCAACGCCCCGGGTCTGCGCAGAGGCCCCTGCAGTCCCTGCCCGGCCCAGTCCGAGCTTCCCGGGCGGGCCCCCAGTCCGGCGATTTGCAGGAACTTTCCCCGGCGCTCCCACGCGAAGC"
seq = "ATGCTGCGCCTATACCCAGGACCGATGGTAACTGAGGCGGAGGGGAAAGGAGGGCCTGAGATGGCAAGTCTGTCCTCCTCGGTGGTTCCTGTGTCCTTCATTTCCACTCTGCGAGAGTCTGTGCTGGACCCTGGAGTTGGTGGAGAAGGAGCCAGTGACAAGCAGAGGAGCAAACTGTCTTTATCACACTCCATGATCCCAGCTGCTAAAATCCACACTGAGCTCTGCTTACCAGCCTTCTTCTCTCCTGCTGGAACCCAGAGGAGGTTCCAGCAGCCTC"
# the above is a user-defined variable; put in your sequence to be Blast against!
class RecInfo():
def __init__(self, a, b, c, d, e, f, g):
self.surroundStart = a
self.surroundEnd = b
self.refStart = c
self.refEnd = d
self.hits = e
self.name = f
self.title = g
self.inCDS = "?"
def printInfo(self):
print "INFORMATION:"
print "-----------"
print "Gene name: ", self.name
print "Location: " , self.refStart, "->", self.refEnd
print "Hit qualification: ", self.hits
print "Surrounding gene information:"
print "----------------------------"
for (sStart, sEnd, n) in zip(self.surroundStart, self.surroundEnd, self.title):
print n, ": " , sStart, "->", sEnd
result_handle = NCBIWWW.qblast("blastn","Test/gpipe/9606/allcontig_and_rna", seq, format_type="HTML") #the db is from the blast homepage (other db's dont give surrounding info) #
blast_results = result_handle.read()#
save_file = open("my_blast2.html","w")#
save_file.write(blast_results)#
save_file.close()#
load_file = open("my_blast2.html","r")
line = load_file.readline()
surroundStart = []
surroundEnd = []
title = []
CDS = "false"
while(line):
findLine = line.find("spanning the HSP") #to find the sequence I
if findLine != -1:
name = line[findLine+23:-1]
findLine = line.find("PREDICTED")
if findLine != -1: #if part of a CDS
end = line.find("Length")
CDS = "true"
break
findLine = line.find("Features flanking this part of subject sequence:")
if findLine != -1: #found features flanking
CDS = "false"
line = load_file.readline()
while line.find("&from=") != -1: #while there is still a feature
w = line.find("&from=") #index of start site
x = line.find("&to=") #index of mid
y = line.find("&view=gbwithparts") #index of end
surroundStart.append(int(line[w+6:x]))
surroundEnd.append(int(line[x+4:y]))
w = line.find("gbwithparts") #index of gene title
x = line.find("</a>") #index of end of title
title.append(line[w+13:x])
line = load_file.readline()
line = load_file.readline() #manual parse
line = load_file.readline() #manual parse
hits = line
seqFirstFound = "false" #if first part found
while line.find("input type") == -1:#while not done with sequence
if line.find("Sbjct") != -1: #if begin
if(seqFirstFound == "false"): #if first sequence
temp = line.split(" ") #split by space
refStart = temp[2]
seqFirstFound = "true"
else: #find end sequence
temp = line[:-1]#delete /n
temp = temp.split(" ")
refEnd = temp[6]
line = load_file.readline()
break
line = load_file.readline()
if CDS == "false":
record = RecInfo(surroundStart, surroundEnd, refStart, refEnd, hits, name, title)
record.printInfo()
else:
print "The snippit is a CDS:"
print "Name: ", name
output
input:
CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACGCATGCCACCCACAACAACTTTTTAAAAGAATCAGACGTGTGAAGGATTCTATTCGAATTACTTCTGCTCTCTGCTTTTATCACTTCACTGTGGGTCTGGGCGCGGGCTTTCTGCCAGCTCCGCGGACGCTGCCTTCGTCCRGCCGCAGAGGCCCCGCGGTCAGGGTCCCGCGTGCGGGGTACCGGGGGCAGAACCAGCGCGTGACCGGGGTCCGCGGTGCCGCAACGCCCCGGGTCTGCGCAGAGGCCCCTGCAGTCCCTGCCCGGCCCAGTCCGAGCTTCCCGGGCGGGCCCCCAGTCCGGCGATTTGCAGGAACTTTCCCCGGCGCTCCCACGCGAAGC
output:
INFORMATION: ----------- Gene name: Homo sapiens chromosome 10 genomic contig, reference assembly Location: 42968870 -> 42969270 Hit qualification: Identities = 400/401 (99%), Gaps = 0/401 (0%) Surrounding gene information: ---------------------------- 3895 bp at 5' side: hypothetical protein : 42962770 -> 42964975 425 bp at 3' side: HtrA serine peptidase 1 : 42969695 -> 43022401
input is a CDS:
ATGCTGCGCCTATACCCAGGACCGATGGTAACTGAGGCGGAGGGGAAAGGAGGGCCTGAGATGGCAAGTCTGTCCTCCTCGGTGGTTCCTGTGTCCTTCATTTCCACTCTGCGAGAGTCTGTGCTGGACCCTGGAGTTGGTGGAGAAGGAGCCAGTGACAAGCAGAGGAGCAAACTGTCTTTATCACACTCCATGATCCCAGCTGCTAAAATCCACACTGAGCTCTGCTTACCAGCCTTCTTCTCTCCTGCTGGAACCCAGAGGAGGTTCCAGCAGCCTC
output (needs cleaned/expanded):
The snippit is a CDS: Name: PREDICTED: Homo sapiens hypothetical LOC387715 (LOC3877.. S=555 E=8.9e-156'" src="images/red.gif" width="500"></a></td>


