Harvard:Biophysics 101/2007/Notebook:Kaull/2007-3-15

From OpenWetWare

Jump to: navigation, search

Homework 3/15/07

See here for assignment.

Part 1: Walk-Through of Analyzing Gene

  • Acquire sequence of interest
>example1                                                                      
CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACG                    
CATGCCACCCACAACAACTTTTTAAAAGAATCAGACGTGTGAAGGATTCTATTCGAATTA                    
CTTCTGCTCTCTGCTTTTATCACTTCACTGTGGGTCTGGGCGCGGGCTTTCTGCCAGCTC                    
CGCGGACGCTGCCTTCGTCCAGCCGCAGAGGCCCCGCGGTCAGGGTCCCGCGTGCGGGGT                    
ACCGGGGGCAGAACCAGCGCGTGACCGGGGTCCGCGGTGCCGCAACGCCCCGGGTCTGCG                    
CAGAGGCCCCTGCAGTCCCTGCCCGGCCCAGTCCGAGCTTCCCGGGCGGGCCCCCAGTCC                    
GGCGATTTGCAGGAACTTTCCCCGGCGCTCCCACGCGAAGC
  • Send to BLAST - identify gene, and note mutations
>ref|NT_030059.12|Hs10_30314  Homo sapiens chromosome 10 genomic contig, reference assembly
Length=44617998

 Features flanking this part of subject sequence:
   3895 bp at 5' side: hypothetical protein
   425 bp at 3' side: HtrA serine peptidase 1


 Score =  787 bits (397),  Expect = 0.0
 Identities = 400/401 (99%), Gaps = 0/401 (0%)
 Strand=Plus/Plus

Query  1         CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACG  60
                 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  42968870  CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACG  42968929

Query  61        CATGCCACCCACAACAACTTTTTAAAAGAATCAGACGTGTGAAGGATTCTATTCGAATTA  120
                 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  42968930  CATGCCACCCACAACAACTTTTTAAAAGAATCAGACGTGTGAAGGATTCTATTCGAATTA  42968989

Query  121       CTTCTGCTCTCTGCTTTTATCACTTCACTGTGGGTCTGGGCGCGGGCTTTCTGCCAGCTC  180
                 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  42968990  CTTCTGCTCTCTGCTTTTATCACTTCACTGTGGGTCTGGGCGCGGGCTTTCTGCCAGCTC  42969049

Query  181       CGCGGACGCTGCCTTCGTCCAGCCGCAGAGGCCCCGCGGTCAGGGTCCCGCGTGCGGGGT  240
                 |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct  42969050  CGCGGACGCTGCCTTCGTCCGGCCGCAGAGGCCCCGCGGTCAGGGTCCCGCGTGCGGGGT  42969109

Query  241       ACCGGGGGCAGAACCAGCGCGTGACCGGGGTCCGCGGTGCCGCAACGCCCCGGGTCTGCG  300
                 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  42969110  ACCGGGGGCAGAACCAGCGCGTGACCGGGGTCCGCGGTGCCGCAACGCCCCGGGTCTGCG  42969169

Query  301       CAGAGGCCCCTGCAGTCCCTGCCCGGCCCAGTCCGAGCTTCCCGGGCGGGCCCCCAGTCC  360
                 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  42969170  CAGAGGCCCCTGCAGTCCCTGCCCGGCCCAGTCCGAGCTTCCCGGGCGGGCCCCCAGTCC  42969229

Query  361       GGCGATTTGCAGGAACTTTCCCCGGCGCTCCCACGCGAAGC  401
                 |||||||||||||||||||||||||||||||||||||||||
Sbjct  42969230  GGCGATTTGCAGGAACTTTCCCCGGCGCTCCCACGCGAAGC  42969270
  • Get location from genome browser: 124210300 - 124210800 on Chromosome 10
  • Identify mutation as an SNP. Search Entrez SNP for the mutant. Obtain a hit:
rs11200638 [Homo sapiens]
AGCTCCGCGGACGCTGCCTTCGTCC[A/G]GCCGCAGAGGCCCCGCGGTCAGGGT
  • Check OMIM for possible diseases linked to the SNP in question.

In this case, the SNP is linked to a ten-fold increase in wet macular degeneration. The patient can be warned to avoid environmental triggers for the disease (such as excess sunlight and hypertension), and perhaps started on preventative treatments.


Part 2: Contribute a Test Case

>KFG (Kay's Favorite Gene)
ATTGCCCCGGTGCTGAGCGGCGCCGCGAGTCGGCCCGAGGCCTCCGGGGACTGCCGTGCCGGGCGGGAGA
CCGCCATGGCGACCCTGGAAAAGCTGATGAAGGCCTTCGAGTCCCTCAAGTCCTTCCAGCAGCAGCAGCA
GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAACAGCCG
CCACCGCCGCCGCCGCCGCCGCCTCCTCAGCTTCCTCAGCCGCCGCCGCAGGCACAGCCGCTGCTGCCTC
AGCCGCAGCCGCCCCCGCCGCCGCCCCCGCCGCCACCCGGCCCGGCTGTGGCTGAGGAGCCGCTGCACCG
ACCGTGAGTTTGGGCCCGCTGCAGCTCCCTGTCCCGGCGGGTCCCAGGCTACGGCGGGGATGGCGGTAAC
CCTGCAGCCTGCGGGCCGGCGACACGAACCCCCGGCCCCGCAGAGACAGAGTGACCCAGCAACCCAGAGC
CCATGAGGGACACCCGCCCCCTCCTGGGGCGAGGCCTTCCCCCACTTCAGCCCCGCTCCCTCACTTGGGT
CTTCCCTTGTCCTCTCGCGAGGGGAGGCAGAGCCTTGTTGGGGCCTGTCCTGAATTCACCGAGGGGAGTC
ACGGCCTCAGCCCTCTCGCCCTTCGCAGGATGCGAAGAGTTGGGGCGAGAACTTGTTTCTTTTTATTTGC
Personal tools