Etchevers:Notebook/STRA6 in eye development/2009/08/01

From OpenWetWare

Jump to: navigation, search
Genetics of human eye development Main project page
Previous entry      Next entry

Choosing mouse primers for ChIP trials upon Nicolas' return

Amorces pour tester enrichissement de fragments après ChIP - souris

  • Typique pour FAIRE chez l'homme
  • Typiquement pas ressortissant par FAIRE

Synteny pour le chromosome 1 vaguement du début jusqu'à 60,000,000 c’est pareil que 90-150,000,000 sur le chromosome 4 de souris (Ensembl). Et de 160,000,000-210,000,000 c’est pareil que de 140,000,000 a la fin sur le chromosome 1 murin.

Si je BLAST une séquence du chr 1 humain elle s'aligne sur le chr 4 murin position 58,680K-63,140K comme attendu entre 4B3 et 4C1, beaucoup de petites séquences alignées.

La demande etait:

07-31 15:29 76HH15VW01N blastn Nucleotide Sequence (7158 letters) 7158 gpipe/10090/all_contig (expires) 08-02 03:29

Parmi les resultats,

ref|NT_039260.7|Mm4_39300_37 Mus musculus chromosome 4 genomi... 1389

Mais il y en avait 96638 d'alignements!!

Parmi eux quelques sequences (et cela formatte tres mal, et je recois l'avertissement "WARNING: This page is 205 kilobytes long; some browsers may have problems editing pages approaching or longer than 32kb. Please consider breaking the page into smaller sections."

Si seulement je voyais comment preserver les retours chariots! >ref|NT_039260.7|Mm4_39300_37 Download subject sequence spanning the HSP Mus musculus chromosome 4 genomic contig, strain C57BL/6J Length=28591323

Features flanking this part of subject sequence:
  7941 bp at 5' side: hypothetical protein LOC52829
  313973 bp at 3' side: multiple PDZ domain protein


Score = 1389 bits (1540),  Expect = 0.0
Identities = 2606/3795 (68%), Gaps = 40/3795 (1%)
Strand=Plus/Minus


Query 2425 AATGGACTAAATGCTCCAATTAAAAGACACAGACTAGCAAATTGGATAAAGAGTCAAGAC 2484


Sbjct 20240169 AATGGTCTCAACTCGCCAATAAAAAGACATAGACTAACAAACTGGTTACAGAAACAAGAC 20240110

Query 2485 CCATCAGTGTGCTGTATTCAGGAAACCCATCTCACATGCAGAGACACACATAGGCTCAAA 2544

| | | |

Sbjct 20240109 CCAACATTTTGCTGCTTACAGGAAACTCATCTCAGAGAAAAAGATAGACACTACCTCAGA 20240050

Query 2545 ATAAAGGGATGGAGGAAGATCTACCAAGCAAACGGAAAACAAAAAAAGGCAGGGGTTGCA 2604

| |

Sbjct 20240049 ATGAAAGGCTGGAAAACAATTTTCCAAGCAAATGGTATGAAGAAACAAGCAGGAGTAGCC 20239990

Query 2605 ATCCTAGTCTCTGATAAAACAGACTTTAAACCAACAAAGATCAAAAGAGACAAAGAAGGC 2664

|

Sbjct 20239989 ATCCTAATATCTGATAAGATTGACTTCCAACCCAAAATCATCAAAAAAGACAAGGAGGGA 20239930

Query 2665 CATTACATAATGGTAAAGGGATCAATTCAACAAGAAGAGCTAACTATCCTAAATATATAT 2724

| | | |

Sbjct 20239929 CACTTCATTCTCATCAAAGGTAAAATCCTCCAAGAGGAACTCTCAATTCTGAATATCTAT 20239870

Query 2725 GCACCCAATACAGGAGCACCAAGATTCA-TAAAGCAAGTCCTGAGTGACCTACAAAG-AG 2782

| | | | |

Sbjct 20239869 GCTCCAAATACAAGAGCAGCCACATTCACTAAAGAAACT--TTAGTAAAGCTCAAAGCAC 20239812

Query 2783 ACTTAGACTCCCACACATTAATAATGGGAGACTTTAACACCCCACTGTCAACATTAGACA 2842

| | |

Sbjct 20239811 ACATTGCGCCTCACACAATAATAGTGGGAGACTTCAACACACCACTTTCACCAATGGACA 20239752

Query 2843 GATCAACGAGACAGAAAGTCAACAAGGATACCCAGGAATTGAACTCAGCTCTGCAGCAAG 2902

| | |

Sbjct 20239751 GATCATGGAAACAGAAACTAAACAGGGACACACTGAAACTAACAGAAGTGATGAAACAAA 20239692

Query 2903 CGGACCTAATAGACATCTACAGAACTCTCCACCCCAAATCAACAGAATATACATTTTTTT 2962

|

Sbjct 20239691 TGGATCTGACAGATATCTACAGAACATTTTTCCCTAAAACAAAAGGATATACCTTCTTCT 20239632

Query 2963 CAGCACCACACCACACCTACTCCAAAATTGACCACATACTGGGAAGTAAAGCACTCCTCA 3022

|

Sbjct 20239631 CAGCACCTCATGGTACCTTCTCCAAAATTGACCACATAATAGGTCACAAATCAGGCCTCA 20239572

Query 3023 GCAAATGTAAAAGAACAGAAATTATAACAAACTATC-TCTCAGACCACAGTGCAATCAAA 3081

|

Sbjct 20239571 ACAGATTCAAAAATATTGAAATTGTCCCATG-TATCCTATCAGATCACCATGCACTAAGG 20239513

Query 3082 CTAGAACT-CAGGATTAAGA-ATCTCACTCAAAACCGCTCAACTACATGGAAACTGAACA 3139

| |

Sbjct 20239512 CT-GATCTTCAATAACAAAATAAATAACAGAAAGCCAA-CATTCACATGGAAACTGAACA 20239455

Query 3140 ACCTGCTCCTGAATGACTACTGGGTACATAACGAAATGAAGGCAGAAATAAAGTTGTTCT 3199

| | |

Sbjct 20239454 ACACTCTTCTCAATGATACCTTGGTCAAGGAAGGAATAAAGAAAGAAATTAAAGACTTTT 20239395

Query 3200 TTGAAACCAATGAGAACAAAGACACAACATACCAGAATCTCTGGGATGCATTCAAAGCAG 3259

Sbjct 20239394 TAGAGTTTAATGAAAATGAAGCCACAACGTACCCAAACCTTTGGGACACAATGAAAGCAT 20239335

Query 3260 TGTGCAGAGGGAAATTTATAGCACTGAATGCCCACAAGAGAAAGCAGGAAAGATCCAAAA 3319

| | | | |

Sbjct 20239334 TTCTAAGAGGGAAACTCATAGCTATGAGTGCCTTCAAGAAAAAACGGGAGAGAGCACATA 20239275

Query 3320 TTGACACCCTAACATCACAATTAAAAGAACTAGAAAAGCAAGA-GCAAACACATTCAAAA 3378

| |

Sbjct 20239274 CTAGCAGCTTGACAACACATCTAAAAGCTCTAGAAAAAAAGGAAGCAAATTCACCCAAGA 20239215

Query 3379 GCTAGCAGAAGGGAAGAAATAACTAAAATCAGAGCAGAACTGAAGGAAATAGAGACACAA 3438

| |

Sbjct 20239214 GG-AGTAGATGGCAGGAAATAATCAAACTCAGGGGTGAAATCAACCAAGTGGAAACAAGA 20239156

Query 3439 AAAACCCTTCAAAAAATTAATGAATCCAGGAGCTGGTTTTTTGAAAGGATAAACAAAATT 3498

|

Sbjct 20239155 AGAACTATTCAAAGAATTAACCAAACGAGGAGTTGGTTCTTTGAGAAAATCAACAAGATA 20239096

Query 3499 GATAGACCGCTAGCAAGACTAA-TAAAGAAAAAAAGAGAGAAGAATCAAATAGATGCAAT 3557

| | | | | |

Sbjct 20239095 GATAAACCCTTAGCTAGACTCACTAAAGGGCACAGG-GACAAAATCCTAATTAACAAAAT 20239037

Query 3558 AAAAAAATGATAAAGGGGATATCACCACCAATCCCACAGAAATACAAACTACCATCAGAG 3617

Sbjct 20239036 CAGAAA-TGAAAAGGGAGACATAACAACAGATCCTGAAGAAATCCAAAACACCATCAGAT 20238978

Query 3618 AATACTACAAACACCTCTACGCAAATAAACTAGAAAATCTAGAAGAAATGGATAAATTCC 3677

|

Sbjct 20238977 CCTTCTACAAAAGGCTATACTCAACAAAACTGGAAAACCTGGACGAAATGGACAAATTTC 20238918

Query 3678 TGGACACATACACTCTCCCAAGACTAAACCAGGAAGAAGTTGAATCTCTGAATAGACCAA 3737

Sbjct 20238917 TGGACAGATACCAGGTACCAAAGTTGAATCAGGATCAAGTTGACCTTCTAAACAGTCCCA 20238858

Query 3738 TAACAGGAGCTGAAATTGTGGCAATAATCAATAGCTTACCAACCAAAAAGAGTCCAGGAC 3797

| | |

Sbjct 20238857 TATCACCTAAAGAAATAGAAGCAGTTATTAATAGTCTCCCAGCCAAAAAAAGCCCAGGAC 20238798

Query 3798 CAGATGGATTCACAGCCGAATTCTACCAGAGGTACAAGGAGGAACTGGTACCATTCCTTC 3857

|

Sbjct 20238797 CAGACGGGTTTAGTGCAGAGTTCTATCAGACCTTCAAAGAAGATCTAACTCCAGTTCTGC 20238738

Query 3858 TGAAACTATTCCAATCAATAGAAAAAGAGGGAATCCTCCCTAACTCATTTTATGACGCCA 3917

Sbjct 20238737 ACAAACTTTTTCACAAGATAGAAGTAGAAGGTATTCTACCCAACTCATTTTATGAAGCCA 20238678

Query 3918 GCATCATTCTGATACCAAAGCCAGGCAGAGACACAACAAAAAAAGAGAATTTTAGACCAA 3977

| | |

Sbjct 20238677 CTATTACTCTGATACCTAAACCACAGAAAGATCCAACAAAGATAGAGAACTTCAGACCAA 20238618

Query 3978 TATCCTTGATGAACATTGAGGCAAAAATCCTCAATAAAACACTGGCAAAATGAATCCAGC 4037

Sbjct 20238617 TTTCTCTTATGAACATCGATGCAAAAATCCTTAATAAAATTCTCGCTAACCGAATCCAAG 20238558

Query 4038 AGCACATCAAAAAGCTTATCCACCATGATCAAGTGGGCTTCATCCCTGGGATGCAAGGCT 4097

| |

Sbjct 20238557 AACACATTAAAGCAATCATCCATCCTGACCAAGTAGGTTTTATTCCAGGGATGCAGGGAT 20238498

Query 4098 GGTTCAATATACGCAAATCAATAAATGTAATCCAGCATAAAAACAGAGCCAAAGACAAAA 4157

|

Sbjct 20238497 GGTTTAATATACGAAAATCCATCAATGTAATCCATTATATAAACAAACTCAAAGACAAAA 20238438

Query 4158 ACCACATGATTATCTCAATAGATGCAGAAAAAGCCTTTGACAAAATTCAACAACCCTTCA 4217

Sbjct 20238437 ACCACATGATCATCTCGTTAGATGCAGAAAAAGCATTTGACAAGATCCAACACCCATTCA 20238378

Query 4218 TGCTAAAAACTCTCAATAAATTAGGTATTGATGGGACGTATTTCAAAATAATAAGAGCTA 4277

| | | |

Sbjct 20238377 TGATAAAAGTTCTGGAAAGATCAGGAATTCAAGGCCAATACCTAAACATGATAAAAGCAA 20238318

Query 4278 TCTATGACAAACCCACAGCCAATATCATACTGAATGGGCAAAAACTGGAAGCATTCTCTT 4337

| |

Sbjct 20238317 TCTACAGCAAACCAGTAGCCAACATCAAAGTAAATGGAGAGAAGCTGGAAGCAATCCCAC 20238258

Query 4338 TGAAAACTGGCACAAGACAGGGATGCCCTCTCTCACCACTCCTATTCAACATAGTGTTGG 4397

| | |

Sbjct 20238257 TAAAATCAGGGACTAGACAAGGCTGCCCACTTTCTCCCTACCTTTTCAACATAGTACTTG 20238198

Query 4398 AAGTTCTGGCCAGGGCAATTAGGCAGGAGAAGGAAATAAAGGGTATTCAATTAGGAAAAG 4457

| |

Sbjct 20238197 AAGTATTAGCCAGAGCAATTCGACAACAAAAGGAGATCAAGGGGATACAAATTGGAAAAG 20238138

Query 4458 AGGAAGTCAAATTGTCCCTGTTTGCAGACGACATGATTGTATATCTAGAAAACCCCATTG 4517

Sbjct 20238137 AGGAAGTCAAAATATCACTTTTTGCAGATGATATGATAGTATATATAAGTGACCCTAAAA 20238078

Query 4518 TCTCAGCCCAAAATCTCCTTAAGCTGATAAGCAACTTCAGCAAAGTCTCAGGATACAAAA 4577

|

Sbjct 20238077 ATTCTACCAGAGAACTCCTAAACCTGATAAACAGCTTCGGTGAAGTAGCTGGATATAAAA 20238018

Query 4578 TCAATGTACAAAAATCACAAGCATTCTTATACACCAACAACAGACAAACAGAGAGCCAAA 4637

| |

Sbjct 20238017 TAAACTCAAACAAGTCAATGGCCTTTCTCTATACAAAGAATAAACAGGCTGAGAAAGAAA 20237958

Query 4638 TCA-TGAGTGAACTCCCATTCACAATTGCTTCAAAGAGAATAAAATACCTAGGAATCCAA 4696

Sbjct 20237957 TTAGGGAAACAACACCC-TTCTCAATAGTCACAAATAATATAAAATATCTTGGCGTGACT 20237899

Query 4697 CTTACAAGGGATGTGAAGGGCCTCTTCAAGGAGAACTACAAACCTCTGCTCAAGGAAATA 4756

| | |

Sbjct 20237898 CTAACTAAGGAGGTGAAAGATCTGTATGATAAAAACTTCAAATCTCTGAAGAAAGAAATT 20237839

Query 4757 AAAGAGGATACAAACAAATGGAAGAACATTCCATGCTCATGGGTAGGAAGAATCAATATC 4816

| | |

Sbjct 20237838 AAAGAAGATCTCAGAAGATGGAAAGATCTCCCATGCTCATGGATTGGCAGGACCAACATT 20237779

Query 4817 GTGAAAATGGCCATACTCCTCAAGGTAATTTACAGATTCAATGCCATCCCCATCAAGCTA 4876

|

Sbjct 20237778 GTAAAAATGGCTATCTTGCCAAAAGCAATCTACAGATTCAATGCAATCCCCATTAAAATT 20237719

Query 4877 CCAATGACTTTCTTCACAGAACTGGAAAAAACTACTTTAAAGTTCATATGGAACCAAAAG 4936

| | | | |

Sbjct 20237718 CCAACTCAATTCTTCAACGAATTAGAAGGAGCAATTTGCAAATTCATCTGGAATAACAAA 20237659

Query 4937 AGAGCCCACATCGCCAAGTCAATCCT--AAGCCAAAAGAACAAAGCTGGAGGCATCACAC 4994

| | |

Sbjct 20237658 AAACCGAGGATAGCAAAAACTCTTCTCAAGGATAAAAGAAC--CTCTGGTGGAATCACCA 20237601

Query 4995 TACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGGTACC 5054

Sbjct 20237600 TGCCTGACCTAAAACTTTACTACAGAGCAATTGTGATAAAAACTGCATGGTACTGGTATA 20237541

Query 5055 AAAACAGAGATATTGATCAATGGAACAGAACAGGGCCCTCAGAAATAACGCCGCATATCT 5114

| | | |

Sbjct 20237540 GAGACAGACAAGTGGACCAATGGAATAGAATTGAAGACCCAGAAATGAACCCACACACCT 20237481

Query 5115 ACAACTATCTGATCTTTGACAAACCTGACAAAAACAAGCAATGGGGAAAGGATTCCCTAT 5174

| | |

Sbjct 20237480 ATGGTCACTTGATCTTCGACAAGGGAGCCAAAACCATCCAGTGGAAGAAAGACAGCATTT 20237421

Query 5175 TTAATAAATGGTGCTGGGAAAACTGGCTAGCCAT-ATGTAGAAAGCTGAAACTGGATCCC 5233

| | |

Sbjct 20237420 TCAACAATTGGTGCTGGCACAACTGG-TTGTTATCATGTAGAAGAATGCGAATCGATCCA 20237362

Query 5234 TTCCTTACACCTTATACAAAAATCAATTCAAGATGGATTAAAGAGTTAAACGTTAGACCT 5293

| | |

Sbjct 20237361 TACTTATCTCCTTGTACTAAGGTCAAATCTAAGTGGATCAAGGAACTTCACATAAAACCA 20237302

Query 5294 AAAACCATAAAAACCCTAGAAGAAAACGTAGGCATTACCATTCAGGACATAGGCATGGGC 5353

| |

Sbjct 20237301 GAGACACTGAAACTTATAGAGGAGAAAGTGGGGAAAAGCCTTGAAGATATGGGCACAGGG 20237242

Query 5354 AAGGACTTCATGTCTAAAACACCAAAAGCAATGGCAACAAAAGACAAAATTGACAAATGG 5413

|

Sbjct 20237241 GAAAAATTCCTGAATAGAACAGCAATGGCTTGTGCTGTAAGATCGAGAATTGACAAATGG 20237182

Query 5414 GATCTAATTAAACTAAAGAGCTTCTGCACAGCAAAAGAAACT-ACCATCAGAGTGAACAG 5472

| |

Sbjct 20237181 GACCTAATGAAACTCCAAAGTTTCTGCAAGGCAAAAGACACTGTCTATAAGA-CAAAAAG 20237123

Query 5473 GCAACCTACAAAATGGGAGAAAATTTTTGC--AACCTACTCATCTGACAAAGGGCTAATA 5530

| | | |

Sbjct 20237122 ACCACCAACAGACTGGGAAAGGATCTTTACCTATCCTA--AATCAGATAGGGGACTAATA 20237065

Query 5531 TCCAGAATCTACAATGAACTCAAACAAATTTACAAGAAAAAAACAAACAACCCCATCAAA 5590

|

Sbjct 20237064 TCCAACATATATAAAGAACTCAAGAAGGTGGACCTCAGAAAATCAAATAACCCCCTTAAA 20237005

Query 5591 AAGTGGGTGAAGGACATGAACAGACACTTCTCA---AAAGAAGACATTTATGCAGCCAAC 5647

|

Sbjct 20237004 AAATGGGGCTCAGAACTGAACAAAGAATTCTCACCTGAGGAATAC-CGAATG--GCAGAG 20236948

Query 5648 AGACACATGAAAAAATGCTCATCATCACTGGCCATCAGAGAAATGCAAATCAAAACCACA 5707

Sbjct 20236947 AAGCACCTGAAAAAATGTTCAACATCCTTAATCATCAGGGAAATGCAAATCAAAACAACC 20236888

Query 5708 ATGAGATACCATCTCACACCAGTTAGAATGGCGATCATTAAAAAGTCAGGAAACAACAGG 5767

Sbjct 20236887 CTGAGATTCCACCTCACACCAGTGAGAATGGCTAAGATCAAAAATTCAGGTGACAGCAGA 20236828

Query 5768 TGCTGGAGAGGATGTGGAGAAATAGGAACATTTTTACACTGTTGGTGGGACTGTAAACTA 5827

| |

Sbjct 20236827 TGCTGGCGAGGATGTGGAGAAAGAGGAACACTCCTCCATTGTTGGTGGGATTGCAGGCTT 20236768

Query 5828 GTTCAACCATTGTGGAAGTCAGTGTGGCGATTCCTCAGGGATCTAGAACTGGAAATACCA 5887

| | |

Sbjct 20236767 GTACAACCACTCTGGAAATCAGTCTGGCGGTTCCTCAGAAAATTGGACATAGTACTACCG 20236708

Query 5888 TTTGACCCAGCCATCCCATTACTGGGTATATACCCAAAGGACTATAAATCATGCTGCT-A 5946

| | | |

Sbjct 20236707 GAGGATCCAGCAATACCTCTCCTGGGCATATATCCAGAAGA----AGCCCCAACTGGTAA 20236652

Query 5947 TAAAGACACATGCACACGTATGTTTATTGCGGCATTATTCACAATAGCAAAGACTTGGAA 6006

| | |

Sbjct 20236651 GAAGGACACATGCTCCACTATGTTCATAGCAGCCTTATTTATAATAGCCAGAAACTGGAA 20236592

Query 6007 CCAACCCAAATGTCTAACAATGATAGACTGGATTAAGAAAATGTGGCACATATACACCAT 6066

|

Sbjct 20236591 AGAAACCAGATGCCCCTCAACAGAGGAATGGATACAGAAAATGTGGTACATCTACACAAT 20236532

Query 6067 GGAATACTATGCAGCCATAAAAAATGATGAGTTCATGTCCTTTGTAGGGACATGGATGAA 6126

| |

Sbjct 20236531 GGAGTACTACTCAGCTATTAAAAAGAATGAATTTATGAAATTCCTAGCCAAATGGATGGA 20236472

Query 6127 ATTGGAAATCATCATTCTCAGTAAACTATCGCAAGAACAAAAAACCAAACACCGCATATT 6186

| | | |

Sbjct 20236471 CCTGGAGAGCATCATCCTGAGTGAGGTAACACAATCACAAAGGAACTCACACAATATGTA 20236412

Query 6187 CTCACTCATAGGTGG 6201

Sbjct 20236411 CTCACTGATAAGTGG 20236397


Features flanking this part of subject sequence:
  30424 bp at 5' side: similar to major urinary protein 1
  42331 bp at 3' side: similar to major urinary protein 1


Score = 1379 bits (1528),  Expect = 0.0
Identities = 2606/3797 (68%), Gaps = 44/3797 (1%)
Strand=Plus/Minus

Query 2425 AATGGACTAAATGCTCCAATTAAAAGACACAGACTAGCAAATTGGATAAAGAGTCAAGAC 2484

|

Sbjct 257771 AATGGTCTCAACTCGCCAATAAAAAGACATAGACTAACAAACTGGCTACACAAACAAGAC 257712

Query 2485 CCATCAGTGTGCTGTATTCAGGAAACCCATCTCACATGCAGAGACACACATAGGCTCAAA 2544

| | | |

Sbjct 257711 CCAACATTTTGCTGCTTACAGGAAACTCATCTCAGAGAAAAAGATAGACACTACCTCAGA 257652

Query 2545 ATAAAGGGATGGAGGAAGATCTACCAAGCAAACGGAAAACAAAAAAAGGCAGGGGTTGCA 2604

| |

Sbjct 257651 ATGAAAGGCTGGAAAACAATTTTCCAAGCAAATGGTATGAAGAAACAAGCAGGAGTAGCC 257592

Query 2605 ATCCTAGTCTCTGATAAAACAGACTTTAAACCAACAAAG--ATCAAAAGAGACAAAGAAG 2662

|

Sbjct 257591 ATCCTAATATCTGATAAGATTGACTTCCAACC--CAAAGTCATCAAAAAAGACAAGGAGG 257534

Query 2663 GCCATTACATAATGGTAAAGGGATCAATTCAACAAGAAGAGCTAACTATCCTAAATATAT 2722

| | | |

Sbjct 257533 GACACTTCATTCTCATCAAAGGTAAAATCCTCCAAGAGGAACTCTCAATTCTGAATATCT 257474

Query 2723 ATGCACCCAATACAGGAGCACCAAGATTCA-TAAAGCAAGTCCTGAGTGACCTACAAAG- 2780

| | | |

Sbjct 257473 ATGCTCCAAATACAAGAGCAGCCACATTCACTAAAGAAACT--TTAGTAAAGCTCAAAGC 257416

Query 2781 AGACTTAGACTCCCACACATTAATAATGGGAGACTTTAACACCCCACTGTCAACATTAGA 2840

| |

Sbjct 257415 ACACATTGCGCCTCACACAATAATAGTGGGAGACTTCAACACACCACTTTCACCAATGGA 257356

Query 2841 CAGATCAACGAGACAGAAAGTCAACAAGGATACCCAGGAATTGAACTCAGCTCTGCAGCA 2900

| | |

Sbjct 257355 CAGATCATGGAAACAGAAACTAAACAGGGACACACTGAAACTAACAGAAGTGATGAAACA 257296

Query 2901 AGCGGACCTAATAGACATCTACAGAACTCTCCACCCCAAATCAACAGAATATACATTTTT 2960

|

Sbjct 257295 AATGGATCTGACAGATATCTAGAGAACATTTTACCCTAAAACAAAAGGATATACCTTCTT 257236

Query 2961 TTCAGCACCACACCACACCTACTCCAAAATTGACCACATACTGGGAAGTAAAGCACTCCT 3020

|

Sbjct 257235 CTCAGCACCTCATGGTACCTTCTCCAAAATTGACCACATAATAGGTCACAAATCAGGCCT 257176

Query 3021 CAGCAAATGTAAAAGAACAGAAATTATAACAAACTATC-TCTCAGACCACAGTGCAATCA 3079

|

Sbjct 257175 CAACAGATTCAAAAATATTGAAATTGTCCCATG-TATCCTATCAGATCACCATGCACTAA 257117

Query 3080 AACTAGAACT-CAGGATTAAGA-ATCTCACTCAAAACCGCTCAACTACATGGAAACTGAA 3137

| |

Sbjct 257116 GGCT-GATCTTCAATAACAAAATAAATAACAGAAAGCCAA-CATTCACATGGAAACTGAA 257059

Query 3138 CAACCTGCTCCTGAATGACTACTGGGTACATAACGAAATGAAGGCAGAAATAAAGTTGTT 3197

| | |

Sbjct 257058 CAACACTCTTCTCAATGATACCTTGGTCAAGGAAGGAATAAAGAAAGAAATTAAAGACTT 256999

Query 3198 CTTTGAAACCAATGAGAACAAAGACACAACATACCAGAATCTCTGGGATGCATTCAAAGC 3257

Sbjct 256998 TTTAGAGTTTAATGAAAATGAAGCCACAACGTACCCAAACCTTTGGGACACAATGAAAGC 256939

Query 3258 AGTGTGCAGAGGGAAATTTATAGCACTGAATGCCCACAAGAGAAAGCAGGAAAGATCCAA 3317

| | | |

Sbjct 256938 ATTTCTAAGAGGGAAACTCATAGCTATGAGTGCCTTCAAGAAAAAACGGGAGAGAGCACA 256879

Query 3318 AATTGACACCCTAACATCACAATTAAAAGAACTAGAAAAGCAAGA-GCAAACACATTCAA 3376

|

Sbjct 256878 TACTAGCAGCTTGACAACACATCTAAAAGCTCTAGAAAAAAAGGAAGCAAATTCACCCAA 256819

Query 3377 AAGCTAGCAGAAGGGAAGAAATAACTAAAATCAGAGCAGAACTGAAGGAAATAGAGACAC 3436

|

Sbjct 256818 GAGG-AGTAGACGGCAGGAAATAATCAAACTCAGGGGTGAAATCAACCAAGTGGAAACAA 256760

Query 3437 AAAAAACCCTTCAAAAAATTAATGAATCCAGGAGCTGGTTTTTTGAAAGGATAAACAAAA 3496

| |

Sbjct 256759 GAAGAACTATTCAAAGAATTAACCAAACGAGGAGTTGGTTCTTTGAGAAAATCAACAAGA 256700

Query 3497 TTGATAGACCGCTAGCAAGACTAA-TAAAGAAAAAAAGAGAGAAGAATCAAATAGATGCA 3555

| | | | | | |

Sbjct 256699 TAGATAAACCCTTAGCTAGACTCACTAAAGGGCACAGG-GACAAAATCCTAATTAACAAA 256641

Query 3556 ATAAAAAAATGATAAAGGGGATATCACCACCAATCCCACAGAAATACAAACTACCATCAG 3615

|

Sbjct 256640 ATCAGAAA-TGAAAAGGGAGACATAACAACAGATCCTGAAGAAATCCAAAACACCATCAG 256582

Query 3616 AGAATACTACAAACACCTCTACGCAAATAAACTAGAAAATCTAGAAGAAATGGATAAATT 3675

Sbjct 256581 ATCCTTCTACAAAAGGCTATACTCAACAAAACTGGAAAACCTGGACGAAATGGACAAATT 256522

Query 3676 CCTGGACACATACACTCTCCCAAGACTAAACCAGGAAGAAGTTGAATCTCTGAATAGACC 3735

Sbjct 256521 TCTGGACAGATACCAGGTACCAAAGTTGAATCAGGATCAAGTTGACCTTCTAAACAGTCC 256462

Query 3736 AATAACAGGAGCTGAAATTGTGGCAATAATCAATAGCTTACCAACCAAAAAGAGTCCAGG 3795

| |

Sbjct 256461 CATATCCCCTAAAGAAATAGTAGCAGTTATTAATAGTCTCCCAGCCAAAAAAAGCCCAGG 256402

Query 3796 ACCAGATGGATTCACAGCCGAATTCTACCAGAGGTACAAGGAGGAACTGGTACCATTCCT 3855

|

Sbjct 256401 ACCAGATGGGTTTAGTGCAGAGTTCTATCAGACCTTCAAAGAAGATCTAACTCCAGTTCT 256342

Query 3856 TCTGAAACTATTCCAATCAATAGAAAAAGAGGGAATCCTCCCTAACTCATTTTATGACGC 3915

Sbjct 256341 GCACAAACTTTTTCACAAGATAGAAGTAGAAGGTATTCTACCCAACTCATTTTATGAAGC 256282

Query 3916 CAGCATCATTCTGATACCAAAGCCAGGCAGAGACACAACAAAAAAAGAGAATTTTAGACC 3975

| |

Sbjct 256281 CACTATTACTCTGATACCTAAACCACAGAAAGATCCAACAAAGATAGAGAACTTCAGACC 256222

Query 3976 AATATCCTTGATGAACATTGAGGCAAAAATCCTCAATAAAACACTGGCAAAATGAATCCA 4035

Sbjct 256221 AATTTCTCTTATGAACATCGATGCAAAAATCCTTAATAAAATTCTCGCTAACCGAATCCA 256162

Query 4036 GCAGCACATCAAAAAGCTTATCCACCATGATCAAGTGGGCTTCATCCCTGGGATGCAAGG 4095

| |

Sbjct 256161 AGAACACATTAAAGCAATCATCCATCCTGACCAAGTAGGTTTTATTCCAGGGATGCAGGG 256102

Query 4096 CTGGTTCAATATACGCAAATCAATAAATGTAATCCAGCATAAAAACAGAGCCAAAGACAA 4155

|

Sbjct 256101 ATGGTTTAATATACGAAAATCCATCAATGTAATCCATTATATAAACAAACTCAAAGACAA 256042

Query 4156 AAACCACATGATTATCTCAATAGATGCAGAAAAAGCCTTTGACAAAATTCAACAACCCTT 4215

Sbjct 256041 AAACCACATGATCATCTCGTTAGATGCAGAAAAAGCATTTGACAAGATCCAACACCCATT 255982

Query 4216 CATGCTAAAAACTCTCAATAAATTAGGTATTGATGGGACGTATTTCAAAATAATAAGAGC 4275

| | |

Sbjct 255981 CATGATAAAAGTTCTGGAAAGATCAGGAATTCAAGGCCAATACCTAAACATGATAAAAGC 255922

Query 4276 TATCTATGACAAACCCACAGCCAATATCATACTGAATGGGCAAAAACTGGAAGCATTCTC 4335

| |

Sbjct 255921 AATCTACAGCAAACCAGTAGCCAACATCAAAGTAAATGGAGAGAAGCTGGAAGCAATCCC 255862

Query 4336 TTTGAAAACTGGCACAAGACAGGGATGCCCTCTCTCACCACTCCTATTCAACATAGTGTT 4395

| |

Sbjct 255861 ACTAAAATCAGGGACTAGACAAGGCTGCCCACTTTCTCCCTACCTTTTCAACATAGTACT 255802

Query 4396 GGAAGTTCTGGCCAGGGCAATTAGGCAGGAGAAGGAAATAAAGGGTATTCAATTAGGAAA 4455

|

Sbjct 255801 TGAAGTATTAGCCAGAGCAATTCGACAACAAAAGGAGATCAAGGGGATACAAATTGGAAA 255742

Query 4456 AGAGGAAGTCAAATTGTCCCTGTTTGCAGACGACATGATTGTATATCTAGAAAACCCCAT 4515

Sbjct 255741 AGAGGAAGTCAAAATATCACTTTTTGCAGATGATATGATAGTATATATAAGTGACCCTAA 255682

Query 4516 TGTCTCAGCCCAAAATCTCCTTAAGCTGATAAGCAACTTCAGCAAAGTCTCAGGATACAA 4575

| | |

Sbjct 255681 AAATTCCAACAGAGAACTCCTAAACCTGATAAACAGCTTCGGTGAAGTAGCTGGATATAA 255622

Query 4576 AATCAATGTACAAAAATCACAAGCATTCTTATACACCAACAACAGACAAACAGAGAGCCA 4635

| |

Sbjct 255621 AATTAACTCAAACAAGTCAATGGCCTTTCTCTACACAAAGAATAAACAGGCTGAGAAAGA 255562

Query 4636 AATCA-TGAGTGAACTCCCATTCACAATTGCTTCAAAGAGAATAAAATACCTAGGAATCC 4694

Sbjct 255561 AATTAGGGAAACAACACCC-TTCTCAATAGCCACAAATAATATAAAATATCTCGGCGTGA 255503

Query 4695 AACTTACAAGGGATGTGAAGGGCCTCTTCAAGGAGAACTACAAACCTCTGCTCAAGGAAA 4754

| | | |

Sbjct 255502 CTCTAACGAAGGAAGTGAAAGATCTGTATGATAAAAACTTCAAGTCCCTGAAGAAAGAAA 255443

Query 4755 TAAAAGAGGATACAAACAAATGGAAGAACATTCCATGCTCATGGGTAGGAAGAATCAATA 4814

| | | |

Sbjct 255442 TTAAAGAAGATCTCAGAAGATGGAAAGATCTCCCATGCTCATGGATTGGCAGGACCAACA 255383

Query 4815 TCGTGAAAATGGCCATACTCCTCAAGGTAATTTACAGATTCAATGCCATCCCCATCAAGC 4874

|

Sbjct 255382 TTGTAAAAATGGCTATCTTGCCAAAAGCAATCTACAGATTCAATGCAATCCCCATTAAAA 255323

Query 4875 TACCAATGACTTTCTTCACAGAACTGGAAAAAACTACTTTAAAGTTCATATGGAACCAAA 4934

| | | | | |

Sbjct 255322 TTCCAACTCAATTCTTCAAGGAATTAGAAGGAGCAATTTGCAAATTCATCTGGAATAACA 255263

Query 4935 AGAGAGCCCACATCGCCAAGTCAATCCT--AAGCCAAAAGAACAAAGCTGGAGGCATCAC 4992

| | | |

Sbjct 255262 AAAAACCGAGGATAGCAAAAACTCTTCTCAAGGATAAAAGAAC--CTCTGGTGGAATCAC 255205

Query 4993 ACTACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGGTA 5052

Sbjct 255204 CATGCCTGACCTAAAGCTTTACTACAGAGCAATTGTGATAAAAACTGCATGGTACTGGTA 255145

Query 5053 CCAAAACAGAGATATTGATCAATGGAACAGAACAGGGCCCTCAGAAATAACGCCGCATAT 5112

| | | |

Sbjct 255144 TAGAGACAGACAAGTGGACCAATGGAATAGAATTGAAGACCCAGAAATGAACCCACACAC 255085

Query 5113 CTACAACTATCTGATCTTTGACAAACCTGACAAAAACAAGCAATGGGGAAAGGATTCCCT 5172

| |

Sbjct 255084 CTATGGTCACTTGATCTTCGACAAGGGAGCCAAAACCATCCAGTGGAAGAAAGACAGCAT 255025

Query 5173 ATTTAATAAATGGTGCTGGGAAAACTGGCTAGCCAT-ATGTAGAAAGCTGAAACTGGATC 5231

| | |

Sbjct 255024 TTTCAACAATTGGTGCTGGCACAACTGG-TTGTTATCATGTAGAAGAATGCGAATCGATC 254966

Query 5232 CCTTCCTTACACCTTATACAAAAATCAATTCAAGATGGATTAAAGAGTTAAACGTTAGAC 5291

| | | |

Sbjct 254965 CATACTTATCTCCTTGTACTAAGGTCAAATCTAAGTGGATCAAGGAACTTCACATAAAAC 254906

Query 5292 CTAAAACCATAAAAACCCTAGAAGAAAACGTAGGCATTACCATTCAGGACATAGGCATGG 5351

| |

Sbjct 254905 CAGAGACACTGAAACTTATAGAGGAGAAAGTGGGGAAAAGCCTTGAAGATATGGGCACAG 254846

Query 5352 GCAAGGACTTCATGTCTAAAACACCAAAAGCAATGGCAACAAAAGACAAAATTGACAAAT 5411

| |

Sbjct 254845 GGGAAAAATTCCTGAACAGAACAGCAATGGCTTGTGCTGTAAGATCGAGAATTGACAAAT 254786

Query 5412 GGGATCTAATTAAACTAAAGAGCTTCTGCACAGCAAAAGAAACT-ACCATCAGAGTGAAC 5470

| |

Sbjct 254785 GGGACCTAATGAAACTCCAAAGTTTCTGCAAGGCAAAAGACACTGTCTATAAGA-CAAAA 254727

Query 5471 AGGCAACCTACAAAATGGGAGAAAATTTTTGC--AACCTACTCATCTGACAAAGGGCTAA 5528

| | | | |

Sbjct 254726 AGACCACCAACAGACTGGGAAAGGATCTTTACCTATCCTA--AATCAGATAGGGGACTAA 254669

Query 5529 TATCCAGAATCTACAATGAACTCAAACAAATTTACAAGAAAAAAACAAACAACCCCATCA 5588

| |

Sbjct 254668 TATCCAACATATATAAAGAACTCAAGAAGGTGGACCTCAGAAAATCAAATAACCCCCTTA 254609

Query 5589 AAAAGTGGGTGAAGGACATGAACAGACACTTCTCA---AAAGAAGACATTTATGCAGCCA 5645

|

Sbjct 254608 AAAAATGGGGCTCAGAACTGAACAAAGAATTCTCACCTGAGGAATAC-CGAATG--GCAG 254552

Query 5646 ACAGACACATGAAAAAATGCTCATCATCACTGGCCATCAGAGAAATGCAAATCAAAACCA 5705

|

Sbjct 254551 AGAAGCACCTGAAAAAATGTTCAACATCCTTAATCATCAGGGAAATGCAAATCAAAACAA 254492

Query 5706 CAATGAGATACCATCTCACACCAGTTAGAATGGCGATCATTAAAAAGTCAGGAAACAACA 5765

Sbjct 254491 CCCTGAGATTCCACCTCACACCAGTGAGAATGGCTAAGATCAAAAATTCAGGTGACAGCA 254432

Query 5766 GGTGCTGGAGAGGATGTGGAGAAATAGGAACATTTTTACACTGTTGGTGGGACTGTAAAC 5825

| | |

Sbjct 254431 GATGCTGGCGAGGATGTGGAGAAAGAGGAACACTCCTCCATTGTTGGTGGGATTGCAGGC 254372

Query 5826 TAGTTCAACCATTGTGGAAGTCAGTGTGGCGATTCCTCAGGGATCTAGAACTGGAAATAC 5885

| | |

Sbjct 254371 TTGTACAACCACTCTGGAAATCAGTCTGGCGGTTCCTCAGAAAATTGGACATAGTACTAC 254312

Query 5886 CATTTGACCCAGCCATCCCATTACTGGGTATATACCCAAAGGACTATAAATCATGCTGCT 5945

| | |

Sbjct 254311 CGGAGGATCCAGCAATACCTCTCCTGGGCATATATCCAGAAGA----AGCCCCAACTGGT 254256

Query 5946 -ATAAAGACACATGCACACGTATGTTTATTGCGGCATTATTCACAATAGCAAAGACTTGG 6004

| | |

Sbjct 254255 AAGAAGGACACATGCTCCACTATGTTCATAGCAGCCTTATTTATAATAGCCAGAAACTGG 254196

Query 6005 AACCAACCCAAATGTCTAACAATGATAGACTGGATTAAGAAAATGTGGCACATATACACC 6064

|

Sbjct 254195 AAAGAACCCAGATGCCCCTCAACAGAGGAATGGATACAGAAAATGTGGTACATCTACACA 254136

Query 6065 ATGGAATACTATGCAGCCATAAAAAATGATGAGTTCATGTCCTTTGTAGGGACATGGATG 6124

|

Sbjct 254135 ATGGAGTACTACTCAGCTATTAAAAAGAATGAATTTATGAAATTCCTAGCCAAATGGATG 254076

Query 6125 AAATTGGAAATCATCATTCTCAGTAAACTATCGCAAGAACAAAAAACCAAACACCGCATA 6184

| | |

Sbjct 254075 GACCTGGAGAGCATCATCCTGAGTGAGGTAACACAATCACAAAGGAACTCACACAATATG 254016

Query 6185 TTCTCACTCATAGGTGG 6201

Sbjct 254015 TACTCACTGATAAGTGG 253999


Features flanking this part of subject sequence:
  85416 bp at 5' side: hypothetical protein
  105101 bp at 3' side: nuclear factor I/B


Score = 1377 bits (1526),  Expect = 0.0
Identities = 2608/3798 (68%), Gaps = 46/3798 (1%)
Strand=Plus/Minus

Query 2425 AATGGACTAAATGCTCCAATTAAAAGACACAGACTAGCAAATTGGATAAAGAGTCAAGAC 2484

|

Sbjct 21466212 AATGGTCTCAACTCGCCAATAAAAAGACATAGACTAACAAACTGGCTACACAAACAAGAC 21466153

Query 2485 CCATCAGTGTGCTGTATTCAGGAAACCCATCTCACATGCAGAGACACACATAGGCTCAAA 2544

| | | |

Sbjct 21466152 CCAACATTTTGCTGCTTACAGGAAACTCATCTCAGAGAAAAAGATAGACACTACCTCAGA 21466093

Query 2545 ATAAAGGGATGGAGGAAGATCTACCAAGCAAACGGAAAACAAAAAAAGGCAGGGGTTGCA 2604

| |

Sbjct 21466092 ATGAAAGGCTGGAAAACAATTTTCCAAGCAAATGGTATGAAGAAACAAGCAGGAGTAGCC 21466033

Query 2605 ATCCTAGTCTCTGATAAAACAGACTTTAAACCAACAAAG--ATCAAAAGAGACAAAGAAG 2662

|

Sbjct 21466032 ATCCTAATATCTGATAAGATTGACTTCCAACC--CAAAGTCATCAAAAAAGACAAGGAGG 21465975

Query 2663 GCCATTACATAATGGTAAAGGGATCAATTCAACAAGAAGAGCTAACTATCCTAAATATAT 2722

| | | |

Sbjct 21465974 GACACTTCATTCTCATCAAAGGTAAAATCCTCCAAGAGGAACTCTCAATTCTGAATATCT 21465915

Query 2723 ATGCACCCAATACAGGAGCACCAAGATTCA-TAAAGCAAGTCCTGAGTGACCTACAAAG- 2780

| | | |

Sbjct 21465914 ATGCTCCAAATACAAGAGCAGCCACATTCACTAAAGAAACT--TTAGTAAAGCTCAAAGC 21465857

Query 2781 AGACTTAGACTCCCACACATTAATAATGGGAGACTTTAACACCCCACTGTCAACATTAGA 2840

| |

Sbjct 21465856 ACACATTGCGCCTCACACAATAATAGTGGGAGACTTCAACACACCACTTTCACCAATGGA 21465797

Query 2841 CAGATCAACGAGACAGAAAGTCAACAAGGATACCCAGGAATTGAACTCAGCTCTGCAGCA 2900

| | |

Sbjct 21465796 CAGATCATGGAAACAGAAACTAAACAGGGACACACTGAAACTAACAGAAGTGATGAAACA 21465737

Query 2901 AGCGGACCTAATAGACATCTACAGAACTCTCCACCCCAAATCAACAGAATATACATTTTT 2960

|

Sbjct 21465736 AATGGATCTGACAGATATCTACAGAACATTTTACCCTAAAACAAAAGGATATACCTTCTT 21465677

Query 2961 TTCAGCACCACACCACACCTACTCCAAAATTGACCACATACTGGGAAGTAAAGCACTCCT 3020

|

Sbjct 21465676 CTCAGCACCTCATGGTACCTTCTCCAAAATTGACCACATAATAGGTCACAAATCAGGCCT 21465617

Query 3021 CAGCAAATGTAAAAGAACAGAAATTATAACAAACTATC-TCTCAGACCACAGTGCAATCA 3079

|

Sbjct 21465616 CAACAGATTCAAAAATATTGAAATTGTCCCATG-TATCCTATCAGATCACCATGCACTAA 21465558

Query 3080 AACTAGAACT-CAGGATTAAGA-ATCTCACTCAAAACCGCTCAACTACATGGAAACTGAA 3137

| |

Sbjct 21465557 GGCT-GATCTTCAATAACAAAATAAATAACAGAAAGCCAA-CATTCACATGGAAACTGAA 21465500

Query 3138 CAACCTGCTCCTGAATGACTACTGGGTACATAACGAAATGAAGGCAGAAATAAAGTTGTT 3197

| | |

Sbjct 21465499 CAACACTCTTCTCAATGATACCTTGGTCAAGGAAGGAATAAAGAAAGAAATTAAAGACTT 21465440

Query 3198 CTTTGAAACCAATGAGAACAAAGACACAACATACCAGAATCTCTGGGATGCATTCAAAGC 3257

Sbjct 21465439 TTTAGAGTTTAATGAAAATGAAGCCACAACGTACCCAAACCTTTGGGACACAATGAAAGC 21465380

Query 3258 AGTGTGCAGAGGGAAATTTATAGCACTGAATGCCCACAAGAGAAAGCAGGAAAGATCCAA 3317

| | | |

Sbjct 21465379 ATTTCTAAGAGGGAAACTCATAGCTATGAGTGCCTTCAAGAAAAAACGGGAGAGAGCACA 21465320

Query 3318 AATTGACACCCTAACATCACAATTAAAAGAACTAGAAAAGCAAGA-GCAAACACATTCAA 3376

|

Sbjct 21465319 TACTAGCAGCTTGACAACACATCTAAAAGCTCTAGAAAAAAAGGAAGCAAATTCACCCAA 21465260

Query 3377 AAGCTAGCAGAAGGGAAGAAATAACTAAAATCAGAGCAGAACTGAAGGAAATAGAGACAC 3436

|

Sbjct 21465259 GAGG-AGTAGACGGCAGGAAATAATCAAACTCAGGGGTGAAATCAACCAAGTGGAAACAA 21465201

Query 3437 AAAAAACCCTTCAAAAAATTAATGAATCCAGGAGCTGGTTTTTTGAAAGGATAAACAAAA 3496

| |

Sbjct 21465200 GAAGAACTATTCAAAGAATTAACCAAACGAGGAGTTGGTTCTTTGAGAAAATCAACAAGA 21465141

Query 3497 TTGATAGACCGCTAGCAAGACTAA-TAAAGAAAAAAAGAGAGAAGAATCAAATAGATGCA 3555

| | | | | | |

Sbjct 21465140 TAGATAAACCCTTAGCTAGACTCACTAAAGGGCACAGG-GACAAAATCCTAATTAACAAA 21465082

Query 3556 ATAAAAAAATGATAAAGGGGATATCACCACCAATCCCACAGAAATACAAACTACCATCAG 3615

|

Sbjct 21465081 ATCAGAAA-TGAAAAGGGAGACATAACAACAGATCCTGAAGAAATCCAAAACACCATCAG 21465023

Query 3616 AGAATACTACAAACACCTCTACGCAAATAAACTAGAAAATCTAGAAGAAATGGATAAATT 3675

Sbjct 21465022 ATCCTTCTACAAAAGGCTATACTCAACAAAACTGGAAAACCTGGACGAAATGGACAAATT 21464963

Query 3676 CCTGGACACATACACTCTCCCAAGACTAAACCAGGAAGAAGTTGAATCTCTGAATAGACC 3735

Sbjct 21464962 TCTGGACAGATACCAGGTACCAAAGTTGAATCAGGATCAAGTTGACCTTCTAAACAGTCC 21464903

Query 3736 AATAACAGGAGCTGAAATTGTGGCAATAATCAATAGCTTACCAACCAAAAAGAGTCCAGG 3795

| | |

Sbjct 21464902 CATATCACCTAAAGAAATAGAAGCAGTTATTAATAGTCTCCCAGCCAAAAAAAGCCCAGG 21464843

Query 3796 ACCAGATGGATTCACAGCCGAATTCTACCAGAGGTACAAGGAGGAACTGGTACCATTCCT 3855

|

Sbjct 21464842 ACCAGACGGGTTTAGTGCAGAGTTCTATCAGACCTTCAAAGAAGATCTAACTCCAGTTCT 21464783

Query 3856 TCTGAAACTATTCCAATCAATAGAAAAAGAGGGAATCCTCCCTAACTCATTTTATGACGC 3915

Sbjct 21464782 GCACAAACTTTTTCACAAGATAGAAGTAGAAGGTATTCTACCCAACTCATTTTATGAAGC 21464723

Query 3916 CAGCATCATTCTGATACCAAAGCCAGGCAGAGACACAACAAAAAAAGAGAATTTTAGACC 3975

| |

Sbjct 21464722 CACTATTACTCTGATACCTAAACCACAGAAAGATCCAACAAAGATAGAGAACTTCAGACC 21464663

Query 3976 AATATCCTTGATGAACATTGAGGCAAAAATCCTCAATAAAACACTGGCAAAATGAATCCA 4035

Sbjct 21464662 AATTTCTCTTATGAACATCGATGCAAAAATCCTTAATAAAATTCTCGCTAACCGAATCCA 21464603

Query 4036 GCAGCACATCAAAAAGCTTATCCACCATGATCAAGTGGGCTTCATCCCTGGGATGCAAGG 4095

| | |

Sbjct 21464602 AGAACACATTAAAGCGATCATCCATCCTGACCAAGTAGGTTTTATTCCAGGGATGCAGGG 21464543

Query 4096 CTGGTTCAATATACGCAAATCAATAAATGTAATCCAGCATAAAAACAGAGCCAAAGACAA 4155

|

Sbjct 21464542 ATGGTTTAATATACGAAAATCCATCAATGTAATCCATTATATAAACAAACTCAAAGACAA 21464483

Query 4156 AAACCACATGATTATCTCAATAGATGCAGAAAAAGCCTTTGACAAAATTCAACAACCCTT 4215

Sbjct 21464482 AAACCACATGATCATCTCGTTAGATGCAGAAAAAGCATTTGACAAGATCCAACACCCATT 21464423

Query 4216 CATGCTAAAAACTCTCAATAAATTAGGTATTGATGGGACGTATTTCAAAATAATAAGAGC 4275

| | |

Sbjct 21464422 CATGATAAAAGTTCTGGAAAGATCAGGAATTCAAGGCCAATACCTAAACATGATAAAAGC 21464363

Query 4276 TATCTATGACAAACCCACAGCCAATATCATACTGAATGGGCAAAAACTGGAAGCATTCTC 4335

| |

Sbjct 21464362 AATCTACAGCAAACCAGTAGCAAACATCAAAGTAAATGGAGAGAAGCTGGAAGCAATCCC 21464303

Query 4336 TTTGAAAACTGGCACAAGACAGGGATGCCCTCTCTCACCACTCCTATTCAACATAGTGTT 4395

| |

Sbjct 21464302 ACTAAAATCAGGGACTAGACAAGGCTGCCCACTTTCTCCCTACCTTTTCAACATAGTACT 21464243

Query 4396 GGAAGTTCTGGCCAGGGCAATTAGGCAGGAGAAGGAAATAAAGGGTATTCAATTAGGAAA 4455

|

Sbjct 21464242 TGAAGTATTAGCCAGAGCAATTCGACAACAAAAGGAGATCAAGGGGATACAAATTGGAAA 21464183

Query 4456 AGAGGAAGTCAAATTGTCCCTGTTTGCAGACGACATGATTGTATAT-CTAGAAAACCCCA 4514

Sbjct 21464182 AGAGGAAGTCAAAATATCACTTTTTGCAGATGATATGATAGTATATGCAAGTGACCCTAA 21464123

Query 4515 TTGTCTCAGCCCAAAATCTCCTTAAGCTGATAAGCAACTTCAGCAAAGTCTCAGGATACA 4574

| |

Sbjct 21464122 AAATTCCAACAGAGAA-CTCCTAAACCTGATAAACAGCTTCGGTGAAGTAGCTGGATATA 21464064

Query 4575 AAATCAATGTACAAAAATCACAAGCATTCTTATACACCAACAACAGACAAACAGAGAGCC 4634

| |

Sbjct 21464063 AAATTAACTCAAACAAGTCAATGGCCTTTCTCTACACAAAGAATAAACAGGCTGAGAAAG 21464004

Query 4635 AAATCA-TGAGTGAACTCCCATTCACAATTGCTTCAAAGAGAATAAAATACCTAGGAATC 4693

|

Sbjct 21464003 AAATTAGGGAAACAACACCC-TTCTCAATAGCCACAAATAATATAAAATATCTCGGCGTG 21463945

Query 4694 CAACTTACAAGGGATGTGAAGGGCCTCTTCAAGGAGAACTACAAACCTCTGCTCAAGGAA 4753

| | | |

Sbjct 21463944 ACTCTAACGAAGGAAGTGAAAGATCTGTATGATAAAAACTTCAAGTCCCTGAAGAAAGAA 21463885

Query 4754 ATAAAAGAGGATACAAACAAATGGAAGAACATTCCATGCTCATGGGTAGGAAGAATCAAT 4813

| | |

Sbjct 21463884 ATTAAAGAAGATCTCAGAAGATGGAAAGATCTCCCATGCTCATGGATTGGCAGGACCAAC 21463825

Query 4814 ATCGTGAAAATGGCCATACTCCTCAAGGTAATTTACAGATTCAATGCCATCCCCATCAAG 4873

|

Sbjct 21463824 ATTGTAAAAATGGCTATCTTGCCAAAAGCAATCTACAGATTCAATGCAATCCCCATTAAA 21463765

Query 4874 CTACCAATGACTTTCTTCACAGAACTGGAAAAAACTACTTTAAAGTTCATATGGAACCAA 4933

| | | | |

Sbjct 21463764 ATTCCAACTCAATTCTTCAACGAATTAGAAGGAGCAATTTGCAAATTCATCTGGAATAAC 21463705

Query 4934 AAGAGAGCCCACATCGCCAAGTCAATCCT--AAGCCAAAAGAACAAAGCTGGAGGCATCA 4991

| | | | |

Sbjct 21463704 AAAAAACCGAGGATAGCAAAAACTCTTCTCAAGGATAAAAGAAC--CTCTGGTGGAATCA 21463647

Query 4992 CACTACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGGT 5051

Sbjct 21463646 CCATGCCTGACCTAAAGCTTTACTACAGAGCAATTGTGATAAAAACTGCATGGTACTGGT 21463587

Query 5052 ACCAAAACAGAGATATTGATCAATGGAACAGAACAGGGCCCTCAGAAATAACGCCGCATA 5111

| | | |

Sbjct 21463586 ATAGAGACAGACAAGTGGACCAATGGAATAGAATTGAAGACCCAGAAATGAACCCACACA 21463527

Query 5112 TCTACAACTATCTGATCTTTGACAAACCTGACAAAAACAAGCAATGGGGAAAGGATTCCC 5171

|

Sbjct 21463526 CCTATGGTCACTTGATCTTCGACAAGGGAGCCAAAACCATCCAGTGGAAGAAAGACAGCA 21463467

Query 5172 TATTTAATAAATGGTGCTGGGAAAACTGGCTAGCCAT-ATGTAGAAAGCTGAAACTGGAT 5230

| | |

Sbjct 21463466 TTTTCAACAATTGGTGCTGGCACAACTGG-TTGTTATCATGTAGAAGAATGCGAATTGAT 21463408

Query 5231 CCCTTCCTTACACCTTATACAAAAATCAATTCAAGATGGATTAAAGAGTTAAACGTTAGA 5290

| | | | | |

Sbjct 21463407 CCATACTTATCTCCTTGTACTAAGGTCAAATCTAAGTGGATCAAGGAACTTCACATAAAA 21463348

Query 5291 CCTAAAACCATAAAAACCCTAGAAGAAAACGTAGGCATTACCATTCAGGACATAGGCATG 5350

| | |

Sbjct 21463347 CCAGAGACACTGAAACTTATAGAGGAGAAAGTGGGGAAAAGCCTTGAAGATATGGGCACA 21463288

Query 5351 GGCAAGGACTTCATGTCTAAAACACCAAAAGCAATGGCAACAAAAGACAAAATTGACAAA 5410

| | |

Sbjct 21463287 GGGGAAAAATTCCTGAACAGAACAGCAATGGCTTGTGCTGTAAGATCGAGAATTGACAAA 21463228

Query 5411 TGGGATCTAATTAAACTAAAGAGCTTCTGCACAGCAAAAGAAACT-ACCATCAGAGTGAA 5469

| |

Sbjct 21463227 TGGGACCTAATGAAACTCCAAAGTTTCTGCAAGGCAAAAGACACTGTCTATAAGA-CAAA 21463169

Query 5470 CAGGCAACCTACAAAATGGGAGAAAATTTTTGC--AACCTACTCATCTGACAAAGGGCTA 5527

| | | | |

Sbjct 21463168 AAGACCACCAACAGACTGGGAAAGGATCTTTACCTATCCTA--AATCAGATAGGGGACTA 21463111

Query 5528 ATATCCAGAATCTACAATGAACTCAAACAAATTTACAAGAAAAAAACAAACAACCCCATC 5587

|

Sbjct 21463110 ATATCCAACATATATAAAGAACTCAAGAAGGTGGACCTCAGAAAATCAAATAACCCCCTT 21463051

Query 5588 AAAAAGTGGGTGAAGGACATGAACAGACACTTCTCA---AAAGAAGACATTTATGCAGCC 5644

|

Sbjct 21463050 AAAAAATGGGGCTCAGAACTGAACAAAGAATTCTCACCTGAGGAATAC-CGAATG--GCA 21462994

Query 5645 AACAGACACATGAAAAAATGCTCATCATCACTGGCCATCAGAGAAATGCAAATCAAAACC 5704

Sbjct 21462993 GAGAAGCACCTGAAAAAATGTTCAACATCCTTAATCATCAGGGAAATGCAAATCAAAACA 21462934

Query 5705 ACAATGAGATACCATCTCACACCAGTTAGAATGGCGATCATTAAAAAGTCAGGAAACAAC 5764

|

Sbjct 21462933 ACCCTGAGATTCCACCTCACACCAGTGAGAATGGCTAAGATCAAAAATTCAGGTGACAGC 21462874

Query 5765 AGGTGCTGGAGAGGATGTGGAGAAATAGGAACATTTTTACACTGTTGGTGGGACTGTAAA 5824

| |

Sbjct 21462873 AGATGCTGGCGAGGATGTGGAGAAAGAGGAACACTCCTCCATTGTTGGTGGGATTGCAGG 21462814

Query 5825 CTAGTTCAACCATTGTGGAAGTCAGTGTGGCGATTCCTCAGGGATCTAGAACTGGAAATA 5884

| | |

Sbjct 21462813 CTTGTACAACCACTCTGGAAATCAGTCTGGCGGTTCCTCAGAAAATTGGACATAGTACTA 21462754

Query 5885 CCATTTGACCCAGCCATCCCATTACTGGGTATATACCCAAAGGACTATAAATCATGCTGC 5944

| |

Sbjct 21462753 CCGGAGGATCCAGCAATACCTCTCCTGGGCATATATCCAGAAGA----AGCCCCAACTGG 21462698

Query 5945 T-ATAAAGACACATGCACACGTATGTTTATTGCGGCATTATTCACAATAGCAAAGACTTG 6003

| | |

Sbjct 21462697 TAAGAAGGACACATGCTCCACTATGTTCATAGCAGCCTTATTTATAATAGCCAGAAACTG 21462638

Query 6004 GAACCAACCCAAATGTCTAACAATGATAGACTGGATTAAGAAAATGTGGCACATATACAC 6063

|

Sbjct 21462637 GAAAGAACCCAGATGCCCCTCAACAGAGGAATGGATACAGAAAATGTGGTACATCTACAC 21462578

Query 6064 CATGGAATACTATGCAGCCATAAAAAATGATGAGTTCATGTCCTTTGTAGGGACATGGAT 6123

|

Sbjct 21462577 AATGGAGTACTACTCAGCTATTAAAAAGAATGAATTTATGAAATTCCTAGCCAAATGGAT 21462518

Query 6124 GAAATTGGAAATCATCATTCTCAGTAAACTATCGCAAGAACAAAAAACCAAACACCGCAT 6183

| | |

Sbjct 21462517 GGACCTGGAGAGCATCATCCTGAGTGAGGTAACACAATCACAAAGGAACTCACACAATAT 21462458

Query 6184 ATTCTCACTCATAGGTGG 6201

Sbjct 21462457 GTACTCACTGATAAGTGG 21462440


Features flanking this part of subject sequence:
  436814 bp at 5' side: tenascin C
  663356 bp at 3' side: pregnancy-associated plasma protein A


Score = 1373 bits (1522),  Expect = 0.0
Identities = 2610/3803 (68%), Gaps = 56/3803 (1%)
Strand=Plus/Plus

Query 2425 AATGGACTAAATGCTCCAATTAAAAGACACAGACTAGCAAATTGGATAAAGAGTCAAGAC 2484

|

Sbjct 3747063 AATGGTCTCAACTCGCCAATAAAAAGACATAGACTAACAAACTGGCTACACAAACAAGAC 3747122

Query 2485 CCATCAGTGTGCTGTATTCAGGAAACCCATCTCACATGCAGAGACACACATAGGCTCAAA 2544

| | | |

Sbjct 3747123 CCAACATTTTGCTGCTTACAGGAAACTCATCTCAGAGAAAAAGATAGACACTACCTCAGA 3747182

Query 2545 ATAAAGGGATGGAGGAAGATCTACCAAGCAAACGGAAAACAAAAAAAGGCAGGGGTTGCA 2604

| |

Sbjct 3747183 ATGAAAGGCTGGAAAACAATTTTCCAAGCAAATGGTATGAAGAAACAAGCAGGAGTAGCC 3747242

Query 2605 ATCCTAGTCTCTGATAAAACAGACTTTAAACCAACAAAG--ATCAAAAGAGACAAAGAAG 2662

|

Sbjct 3747243 ATCCTAATATCTGATAAGATTGACTTCCAACC--CAAAGTCATCAAAAAAGACAAGGAGG 3747300

Query 2663 GCCATTACATAATGGTAAAGGGATCAATTCAACAAGAAGAGCTAACTATCCTAAATATAT 2722

| | | |

Sbjct 3747301 GACACTTCATTCTCATCAAAGGTAAAATCCTCCAAGAGGAACTCTCAATTCTGAATATCT 3747360

Query 2723 ATGCACCCAATACAGGAGCACCAAGATTCA-TAAAGCAAGTCCTGAGTGACCTACAAAG- 2780

| | | |

Sbjct 3747361 ATGCTCCAAATACAAGAGCAGCCACATTCACTAAAGAAACT--TTAGTAAAGCTCAAAGC 3747418

Query 2781 AGACTTAGACTCCCACACATTAATAATGGGAGACTTTAACACCCCACTGTCAACATTAGA 2840

| |

Sbjct 3747419 ACACATTGCACCTCACACAATAATAGTGGGAGACTTCAACACACCACTTTCACCAATGGA 3747478

Query 2841 CAGATCAACGAGACAGAAAGTCAACAAGGATACCCAGGAATTGAACTCAGCTCTGCAGCA 2900

| | |

Sbjct 3747479 CAGATCATGGAAACAGAAACTAAACAGGGACACACTGAAACTAACAGAAGTGATGAAACA 3747538

Query 2901 AGCGGACCTAATAGACATCTACAGAACTCTCCACCCCAAATCAACAGAATATACATTTTT 2960

| |

Sbjct 3747539 AATGGATCTGACAGATATCTACAGAACATTTTATCCTAAAACAAAAGGATATACCTTCTT 3747598

Query 2961 TTCAGCACCACACCACACCTACTCCAAAATTGACCACATACTGGGAAGTAAAGCACTCCT 3020

|

Sbjct 3747599 CTCAGCACCTCATGGTACCTTCTCCAAAATTGACCACATAATAGGTCACAAATCAGGCCT 3747658

Query 3021 CAGCAAATGTAAAAGAACAGAAATTATAACAAACTATC-TCTCAGACCACAGTGCAATCA 3079

|

Sbjct 3747659 CAACAGATGCAAAAATATTGAAATTGTCCCATG-TATCCTATCAGATCACCATGCACTAA 3747717

Query 3080 AACTAGAACT-CAGGATTAAGA-ATCTCACTCAAAACCGCTCAACTACATGGAAACTGAA 3137

| |

Sbjct 3747718 GGCT-GATCTTCAATAACAAAATAAATAACAGAAAGCCAA-CATTCACATGGAAACTGAA 3747775

Query 3138 CAACCTGCTCCTGAATGACTACTGGGTACATAACGAAATGAAGGCAGAAATAAAGTTGTT 3197

| | |

Sbjct 3747776 CAACACTCTTCTCAATGATACCTTGGTCAAGGAAGGAATAAAGAAAGAAATTAAAGACTT 3747835

Query 3198 CTTTGAAACCAATGAGAACAAAGACACAACATACCAGAATCTCTGGGATGCATTCAAAGC 3257

Sbjct 3747836 TTTAGAGTTTAATGACAATGAAGCCACAACGTACCCAAACCTTTGGGACACAATGAAAGC 3747895

Query 3258 AGTGTGCAGAGGGAAATTTATAGCACTGAATGCCCACAAGAGAAAGCAGGAAAGATCCAA 3317

| | | |

Sbjct 3747896 ATTTCTAAGAGGGAAACTCATAGCTATGAGTGCCTTCAAGAAAAAACGGGAGAGAGCACA 3747955

Query 3318 AATTGACACCCTAACATCACAATTAAAAGAACTAGAAAAGCAAGA-GCAAACACATTCAA 3376

|

Sbjct 3747956 TACTAGCAGCTTGACAACACATCTAAAAGCTCTAGAAAAAAAGGAAGCAAATTCACCCAA 3748015

Query 3377 AAGCTAGCAGAAGGGAAGAAATAACTAAAATCAGAGCAGAACTGAAGGAAATAGAGACAC 3436

|

Sbjct 3748016 GAGG-AGTAGACGGCAGGAAATAATCAAACTCAGGGGTGAAATCAACCAAGTGGAAACAA 3748074

Query 3437 AAAAAACCCTTCAAAAAATTAATGAATCCAGGAGCTGGTTTTTTGAAAGGATAAACAAAA 3496

| |

Sbjct 3748075 GAAGAACTATTCAAAGAATTAACCAAACGAGGAGTTGGTTCTTTGAGAAAATCAACAAGA 3748134

Query 3497 TTGATAGACCGCTAGCAAGACTAA-TAAAGAAAAAAAGAGAGAAGAATCAAATAGATGCA 3555

| | | | | | |

Sbjct 3748135 TAGATAAACCCTTAGCTAGACTCACTAAAGGGCACAGG-GACAAAATCCTAATTAACAAA 3748193

Query 3556 ATAAAAAAATGATAAAGGGGATATCACCACCAATCCCACAGAAATACAAACTACCATCAG 3615

|

Sbjct 3748194 ATCAGAAA-TGAAAAGGGAGACATAACAACAGATCCTGAAGAAATCCAAAACACCATCAG 3748252

Query 3616 AGAATACTACAAACACCTCTACGCAAATAAACTAGAAAATCTAGAAGAAATGGATAAATT 3675

Sbjct 3748253 ATCCTTCTACAAAAGGCTATACTCAACAAAACTGGAAAACCTGGACGAAATGGACAAATT 3748312

Query 3676 CCTGGACACATACACTCTCCCAAGACTAAACCAGGAAGAAGTTGAATCTCTGAATAGACC 3735

Sbjct 3748313 TCTGGACAGATACCAGGTACCAAAGTTGAATCAGGATCAAGTTGACCTTCTAAACAGTCC 3748372

Query 3736 AATAACAGGAGCTGAAATTGTGGCAATAATCAATAGCTTACCAACCAAAAAGAGTCCAGG 3795

| | |

Sbjct 3748373 CATATCCCCTAAAGAAATAGAAGCAGTTATTAATAGTCTCCCAGCCAAAAAAAGCCCAGG 3748432

Query 3796 ACCAGATGGATTCACAGCCGAATTCTACCAGAGGTACAAGGAGGAACTGGTACCATTCCT 3855

|

Sbjct 3748433 ACCAGACGGGTTTAGTGCAGAGTTCTATCAGACCTTCAAAGAAGATCTAACTCCAGTTCT 3748492

Query 3856 TCTGAAACTATTCCAATCAATAGAAAAAGAGGGAATCCTCCCTAACTCATTTTATGACGC 3915

Sbjct 3748493 GCACAAACTTTTTCACAAGATAGAAGTAGAAGGTATTCTACCCAACTCATTTTATGAAGC 3748552

Query 3916 CAGCATCATTCTGATACCAAAGCCAGGCAGAGACACAACAAAAAAAGAGAATTTTAGACC 3975

| |

Sbjct 3748553 CACTATTACTCTGATACCTAAACCACAGAAAGATCCAACAAAGATAGAGAACTTCAGACC 3748612

Query 3976 AATATCCTTGATGAACATTGAGGCAAAAATCCTCAATAAAACACTGGCAAAATGAATCCA 4035

Sbjct 3748613 AATTTCTCTTATGAACATCGATGCAAAAATTCTTAATAAAATTCTCGCTAACCGAATCCA 3748672

Query 4036 GCAGCACATCAAAAAGCTTATCCACCATGATCAAGTGGGCTTCATCCCTGGGATGCAAGG 4095

| |

Sbjct 3748673 AGAACACATTAAAGCAATCATCCATCCTGACCAAGTAGGTTTTATTCCAGGGATGCAGGG 3748732

Query 4096 CTGGTTCAATATACGCAAATCAATAAATGTAATCCAGCATAAAAACAGAGCCAAAGACAA 4155

|

Sbjct 3748733 ATGGTTTAATATACGAAAATCCATCAATGTAATCCATTATATAAACAAACTCAAAGACAA 3748792

Query 4156 AAACCACATGATTATCTCAATAGATGCAGAAAAAGCCTTTGACAAAATTCAACAACCCTT 4215

Sbjct 3748793 AAACCACATGATCATCTCGTTAGATGCAGAAAAAGCATTTGACAAGATCCAACACCCATT 3748852

Query 4216 CATGCTAAAAACTCTCAATAAATTAGGTATTGATGGGACGTATTTCAAAATAATAAGAGC 4275

| | |

Sbjct 3748853 CATGATAAAAGTTCTGGAAAGATCAGGAATTCAAGGCCAATACCTAAACATGATAAAAGC 3748912

Query 4276 TATCTATGACAAACCCACAGCCAATATCATACTGAATGGGCAAAAACTGGAAGCATTCTC 4335

| |

Sbjct 3748913 AATCTACAGCAAACCAGTAGCCAACATCAAAGTAAATGGAGAGAAGCTGGAAGCAATCCC 3748972

Query 4336 TTTGAAAACTGGCACAAGACAGGGATGCCCTCTCTCACCACTCCTATTCAACATAGTGTT 4395

| |

Sbjct 3748973 ACTAAAATCAGGGACTAGACAAGGCTGCCCACTTTCTCCCTACCTTTTCAACATAGTACT 3749032

Query 4396 GGAAGTTCTGGCCAGGGCAATTAGGCAGGAGAAGGAAATAAAGGGTATTCAATTAGGAAA 4455

|

Sbjct 3749033 TGAAGTATTAGCCAGAGCAATTCGACAACAAAAGGAGATCAAGGGGATACAAATTGGAAA 3749092

Query 4456 AGAGGAAGTCAAATTGTCCCTGTTTGCAGACGACATGATTGTATATCTAGAAAACCCCAT 4515

Sbjct 3749093 AGAGGAAGTCAAAATATCACTTTTTGCAGATGATATGATAGTATATATAAGTGACCCTAA 3749152

Query 4516 TGTCTCAGCCCAAAATCTCCTTAAGCTGATAAGCAACTTCAGCAAAGTCTCAGGATACAA 4575

| | |

Sbjct 3749153 AAATTCCAACAGAGAACTCCTAAACCTGATAAACAGCTTCGGTGAAGTAGCTGGATATAA 3749212

Query 4576 AATCAATGTACAAAAATCACAAGCATTCTTATACACCAACAACAGACAAACAGAGAGCCA 4635

| |

Sbjct 3749213 AATTAACTCAAACAAGTCAATGGCCTTTCTCTACACAAAGAATAAACAGGCTGAGAAAGA 3749272

Query 4636 AATCA-TGAGTGAACTCCCATTCACAATTGCTTCAAAGAGAATAAAATACCTAGGAATCC 4694

Sbjct 3749273 AATTAGGGAAACAACACCC-TTCTCAATAGCCACAAATAATATAAAATATCTCGGCGTGA 3749331

Query 4695 AACTTACAAGGGATGTGAAGGGCCTCTTCAAGGAGAACTACAAACCTCTGCTCAAGGAAA 4754

| | | |

Sbjct 3749332 CTCTAACGAAGGAAGTGAAAGATCTGTATGATAAAAACTTCAAGTCCCTGAAGAAAGAAA 3749391

Query 4755 TAAAAGAGGATACAAACAAATGGAAGAACATTCCATGCTCATGGGTAGGAAGAATCAATA 4814

| | | |

Sbjct 3749392 TTAAAGAAGATCTCAGAAGATGGAAAGATCTCCCATGCTCATGGATTGGCAGGACCAACA 3749451

Query 4815 TCGTGAAAATGGCCATACTCCTCAAGGTAATTTACAGATTCAATGCCATCCCCATCAAGC 4874

|

Sbjct 3749452 TTGTAAAAATGGCTATCTTGCCAAAAGCAATCTACAGATTCAATGCAATCCCCATTAAAA 3749511

Query 4875 TACCAATGACTTTCTTCACAGAACTGGAAAAAACTACTTTAAAGTTCATATGGAACCAAA 4934

| | | | | |

Sbjct 3749512 TTCCAACTCAATTCTTCAACGAATTAGAAGGAGCAATTTGCAAATTCATCTGGAATAACA 3749571

Query 4935 AGAGAGCCCACATCGCCAAGTCAATCCT--AAGCCAAAAGAACAAAGCTGGAGGCATCAC 4992

| | | |

Sbjct 3749572 AAAAACCGAGGATAGCAAAAACTCTTCTCAAGGATAAAAGAAC--CTCTGGTGGAATCAC 3749629

Query 4993 ACTACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGGTA 5052

Sbjct 3749630 CATGCCTGACCTCAAGCTTTACTACAGAGCAATTGTGATAAAAACTGCATGGTACTGGTA 3749689

Query 5053 CCAAAACAGAGATATTGATCAATGGAACAGAACAGGGCCCTCAGAAATAACGCCGCATAT 5112

| | | |

Sbjct 3749690 TAGAGACAGACAAGTGGACCAATGGAATAGAATTGAAGACCCAGAAATGAACCCACACAC 3749749

Query 5113 CTACAACTATCTGATCTTTGACAAACCTGACAAAAACAAGCAATGGGGAAAGGATTCCCT 5172

| |

Sbjct 3749750 CTATGGTCACTTGATCTTCGACAAGGGAGCCAAAACCATCCAGTGGAAGAAAGACAGCAT 3749809

Query 5173 ATTTAATAAATGGTGCTGGGAAAACTGGCTAGCCAT-ATGTAGAAAGCTGAAACTGGATC 5231

| | |

Sbjct 3749810 TTTCAACAATTGGTGCTGGCACAACTGG-TTGTTATCATGTAGAAGAATGCGAATCGATC 3749868

Query 5232 CCTTCCTTACACCTTATACAAAAATCAATTCAAGATGGATTAAAGAGTTAAACGTTAGAC 5291

| | | |

Sbjct 3749869 CATACTTATCTCCTTGTACTAAGGTCAAATCTAAGTGGATCAAGGAACTTCACATAAAAC 3749928

Query 5292 CTAAAACCATAAAAACCCTAGAAGAAAACGTAGGCATTACCATTCAGGACATAGGCATGG 5351

| |

Sbjct 3749929 CAGAGACACTGAAACTTATAGAGGAGAAAGTGGGGAAAAGCCTTGAAGATATGGGCACAG 3749988

Query 5352 GCAAGGACTTCATGTCTAAAACACCAAAAGCAATGGC---AAC---AAAAGACAAAATTG 5405

| |

Sbjct 3749989 GGGAAAAATTCCTG-----AACA-GAACAGCAATGGCTTGTACTGTAAGATCGAGAATTG 3750042

Query 5406 ACAAATGGGATCTAATTAAACTAAAGAGCTTCTGCACAGCAAAAGAAACT-ACCATCAGA 5464

| |

Sbjct 3750043 ACAAATGGGACCTAATGAAACTCCAAAGTTTCTGCAAGGCAAAAGACACTGTCTATAAGA 3750102

Query 5465 GTGAACAGGCAACCTACAAAATGGGAGAAAATTTTTGC--AACCTACTCATCTGACAAAG 5522

| | | | |

Sbjct 3750103 -CAAAAAGACCACCAACAGACTGGGAAAGGATCTTTACCTATCCTA--AATCAGATAGGG 3750159

Query 5523 GGCTAATATCCAGAATCTACAATGAACTCAAACAAATTTACAAGAAAAAAACAAACAACC 5582

|

Sbjct 3750160 GACTAATATCCAACATATATAAAGAACTCAAGAAGGTGGACCTCAGAAAATCAAATAACC 3750219

Query 5583 CCATCAAAAAGTGGGTGAAGGACATGAACAGACACTTCTCA---AAAGAAGACATTTATG 5639

| |

Sbjct 3750220 CCCTTAAAAAATGGGGCTCAGAACTGAACAAAGAATTCTCACCTGAGGAATAC-CGAATG 3750278

Query 5640 CAGCCAACAGACACATGAAAAAATGCTCATCATCACTGGCCATCAGAGAAATGCAAATCA 5699

| |

Sbjct 3750279 --GCAGAGAAGCACCTGAAAAAATGTTCAACATCCTTAATCATCAGGGAAATGCAAATCA 3750336

Query 5700 AAACCACAATGAGATACCATCTCACACCAGTTAGAATGGCGATCATTAAAAAGTCAGGAA 5759

Sbjct 3750337 AAACAACCCTGAGATTCCACCTCACACCAGTGAGAATGGCTAAGATCAAAAATTCAGGTG 3750396

Query 5760 ACAACAGGTGCTGGAGAGGATGTGGAGAAATAGGAACATTTTTACACTGTTGGTGGGACT 5819

| | |

Sbjct 3750397 ACAGCAGATGCTGGCGAGGATGTGGAGAAAGAGGAACACTCCTCCATTGTTGGTGGGATT 3750456

Query 5820 GTAAACTAGTTCAACCATTGTGGAAGTCAGTGTGGCGATTCCTCAGGGATCTAGAACTGG 5879

| |

Sbjct 3750457 GCAGGCTTGTACAACCACTCTGGAAATCAGTCTGGCGGTTCCTCAGAAAATTGGACATAG 3750516

Query 5880 AAATACCATTTGACCCAGCCATCCCATTACTGGGTATATACCCAAAGGACTATAAATCAT 5939

| |

Sbjct 3750517 TACTACCGGAGGATCCAGCAATACCTCTCCTGGGCATATATCCAGAAGA----AGCCCCA 3750572

Query 5940 GCTGCT-ATAAAGACACATGCACACGTATGTTTATTGCGGCATTATTCACAATAGCAAAG 5998

| | |

Sbjct 3750573 ACTGGTAAGAAGGACACATGCTCCACTATGTTCATAGCAGCCTTATTTATAATAGCCAGA 3750632

Query 5999 ACTTGGAACCAACCCAAATGTCTAACAATGATAGACTGGATTAAGAAAATGTGGCACATA 6058

|

Sbjct 3750633 AACTGGAAAGAACCCAGATGCCCCTCAACAGAGGAATGGATACAGAAAATGTGGTACATC 3750692

Query 6059 TACACCATGGAATACTATGCAGCCATAAAAAATGATGAGTTCATGTCCTTTGTAGGGACA 6118

| |

Sbjct 3750693 TACACAATGGAGTACTACTCAGCTATTAAAAAGAATGAATTTATGAAATTCCTAGCCAAA 3750752

Query 6119 TGGATGAAATTGGAAATCATCATTCTCAGTAAACTATCGCAAGAACAAAAAACCAAACAC 6178

| | | |

Sbjct 3750753 TGGATGGACCTGGAGAGCATCATCCTGAGTGAGGTAACACAATCACAAAGGAACTCACAC 3750812

Query 6179 CGCATATTCTCACTCATAGGTGG 6201

|

Sbjct 3750813 AATATGTACTCACTGATAAGTGG 3750835


Features flanking this part of subject sequence:
  447385 bp at 5' side: solute carrier family 24 (sodium/potassium/calcium exchan...
  95043 bp at 3' side: myeloid/lymphoid or mixed lineage-leukemia translocation ...


Score = 1373 bits (1522),  Expect = 0.0
Identities = 2605/3797 (68%), Gaps = 44/3797 (1%)
Strand=Plus/Minus

Query 2425 AATGGACTAAATGCTCCAATTAAAAGACACAGACTAGCAAATTGGATAAAGAGTCAAGAC 2484

|

Sbjct 26953491 AATGGTCTCAACTCGCCAATAAAAAGACATAGACTAACAAACTGGCTACACAAACAAGAC 26953432

Query 2485 CCATCAGTGTGCTGTATTCAGGAAACCCATCTCACATGCAGAGACACACATAGGCTCAAA 2544

| | | |

Sbjct 26953431 ACAACATTTTGCTGCTTACAGGAAACTCATCTCAGAGAAAAAGATAGACACTACCTCAGA 26953372

Query 2545 ATAAAGGGATGGAGGAAGATCTACCAAGCAAACGGAAAACAAAAAAAGGCAGGGGTTGCA 2604

| |

Sbjct 26953371 ATGAAAGGCTGGAAAACAATTTTCCAAGCAAATGGTATGAAGAAACAAGCAGGAGTAGCC 26953312

Query 2605 ATCCTAGTCTCTGATAAAACAGACTTTAAACCAACAAAG--ATCAAAAGAGACAAAGAAG 2662

|

Sbjct 26953311 ATCCTAATATCTGATAAGATTGACTTCCAACC--CAAAGTCATCAAAAAAGACAAGGAGG 26953254

Query 2663 GCCATTACATAATGGTAAAGGGATCAATTCAACAAGAAGAGCTAACTATCCTAAATATAT 2722

| | | |

Sbjct 26953253 GACACTTCATTCTCATCAAAGGTAAAATCCTCCAAGAGGAACTCTCAATTCTGAATATCT 26953194

Query 2723 ATGCACCCAATACAGGAGCACCAAGATTCA-TAAAGCAAGTCCTGAGTGACCTACAAAG- 2780

| | | |

Sbjct 26953193 ATGCTCCAAATACAAGAGCAGCCACATTCACTAAAGAAACT--TTAGTAAAGCTCAAAGC 26953136

Query 2781 AGACTTAGACTCCCACACATTAATAATGGGAGACTTTAACACCCCACTGTCAACATTAGA 2840

| |

Sbjct 26953135 ACACATTGCGCCTCACACAATAATAGTGGGAGACTTCAACACACCACTTTCACCAATGGA 26953076

Query 2841 CAGATCAACGAGACAGAAAGTCAACAAGGATACCCAGGAATTGAACTCAGCTCTGCAGCA 2900

| | |

Sbjct 26953075 CAGATCATGGAAACAGAAACTAAACAGGGACACACTGAAACTAACAGAAGTGATGAAACA 26953016

Query 2901 AGCGGACCTAATAGACATCTACAGAACTCTCCACCCCAAATCAACAGAATATACATTTTT 2960

|

Sbjct 26953015 AATGGATCTGACAGATATCTACAGAACATTTTACCCTAAAACAAAAGGATATACCTTCTT 26952956

Query 2961 TTCAGCACCACACCACACCTACTCCAAAATTGACCACATACTGGGAAGTAAAGCACTCCT 3020

|

Sbjct 26952955 CTCAGCACCTCATGGTACCTTCTCCAAAATTGACCACATAATAGGTCACAAATCAGGCCT 26952896

Query 3021 CAGCAAATGTAAAAGAACAGAAATTATAACAAACTATC-TCTCAGACCACAGTGCAATCA 3079

|

Sbjct 26952895 CAACAGATTCAAAAATATTGAAATTGTCCCATG-TATCCTATCAGATCACCATGCACTAA 26952837

Query 3080 AACTAGAACT-CAGGATTAAGA-ATCTCACTCAAAACCGCTCAACTACATGGAAACTGAA 3137

| |

Sbjct 26952836 GGCT-GATCTTCAATAACAAAATAAATAACAGAAAGCCAA-CATTCACATGGAAACTGAA 26952779

Query 3138 CAACCTGCTCCTGAATGACTACTGGGTACATAACGAAATGAAGGCAGAAATAAAGTTGTT 3197

| | |

Sbjct 26952778 CAACACTCTTCTCAATGATACCTTGGTCAAGGAAGGAATAAAGAAAGAAATTAAAGACTT 26952719

Query 3198 CTTTGAAACCAATGAGAACAAAGACACAACATACCAGAATCTCTGGGATGCATTCAAAGC 3257

Sbjct 26952718 TTTAGAGTTTAATGAAAATGAAGCCACAACGTACCCAAACCTTTGGGACACAATGAAAGC 26952659

Query 3258 AGTGTGCAGAGGGAAATTTATAGCACTGAATGCCCACAAGAGAAAGCAGGAAAGATCCAA 3317

| | | |

Sbjct 26952658 ATTTCTAAGAGGGAAACTCATAGCTATGAGTGCCTTCAAGAAAAAACGGGAGAGAGCACA 26952599

Query 3318 AATTGACACCCTAACATCACAATTAAAAGAACTAGAAAAGCAAGA-GCAAACACATTCAA 3376

|

Sbjct 26952598 TACTAGCAGCTTGACAACACATCTAAAAGCTCTAGAAAAAAAGGAAGCAAATTCACCCAA 26952539

Query 3377 AAGCTAGCAGAAGGGAAGAAATAACTAAAATCAGAGCAGAACTGAAGGAAATAGAGACAC 3436

|

Sbjct 26952538 GAGG-AGTAGACGGCAGGAAATAATCAAACTCAGGGGTGAAATCAACCAAGTGGAAACAA 26952480

Query 3437 AAAAAACCCTTCAAAAAATTAATGAATCCAGGAGCTGGTTTTTTGAAAGGATAAACAAAA 3496

| |

Sbjct 26952479 GAAGAACTATTCAAAGAATTAACCAAACGAGGAGTTGGTTCTTTGAGAAAATCAACAAGA 26952420

Query 3497 TTGATAGACCGCTAGCAAGACTAA-TAAAGAAAAAAAGAGAGAAGAATCAAATAGATGCA 3555

| | | | | | |

Sbjct 26952419 TAGATAAACCCTTAGCTAGACTCACTAAAGGGCACAGG-GACAAAATCCTAATTAACAAA 26952361

Query 3556 ATAAAAAAATGATAAAGGGGATATCACCACCAATCCCACAGAAATACAAACTACCATCAG 3615

|

Sbjct 26952360 ATCAGAAA-TGAAAAGGGAGACATAACAACAGATCCTGAAGAAATCCAAAACACCATCAG 26952302

Query 3616 AGAATACTACAAACACCTCTACGCAAATAAACTAGAAAATCTAGAAGAAATGGATAAATT 3675

Sbjct 26952301 ATCCTTCTACAAAAGGCTATACTCAACAAAACTGGAAAACCTGGACGAAATGGACAAATT 26952242

Query 3676 CCTGGACACATACACTCTCCCAAGACTAAACCAGGAAGAAGTTGAATCTCTGAATAGACC 3735

Sbjct 26952241 TCTGGACAGATACCAGGTACCAAAGTTGAATCAGGATCAAGTTGACCTTCTAAACAGTCC 26952182

Query 3736 AATAACAGGAGCTGAAATTGTGGCAATAATCAATAGCTTACCAACCAAAAAGAGTCCAGG 3795

| | |

Sbjct 26952181 CATATCCCCTAAAGAAATAGAAGCAGTTATTAATAGTCTCCCAGCCAAAAAAAGCCCAGG 26952122

Query 3796 ACCAGATGGATTCACAGCCGAATTCTACCAGAGGTACAAGGAGGAACTGGTACCATTCCT 3855

|

Sbjct 26952121 ACCAGACGGGTTTAGTGCAGAGTTCTATCAGACCTTCAAAGAAGATCTAACTCCAGTTCT 26952062

Query 3856 TCTGAAACTATTCCAATCAATAGAAAAAGAGGGAATCCTCCCTAACTCATTTTATGACGC 3915

Sbjct 26952061 GCACAAACTTTTTCACAAGATAGAAGTAGAAGGTATTCTACCCAACTCATTTTATGAAGC 26952002

Query 3916 CAGCATCATTCTGATACCAAAGCCAGGCAGAGACACAACAAAAAAAGAGAATTTTAGACC 3975

| |

Sbjct 26952001 CACTATTACTCTGATACCTAAACCACAGAAAGATCCAACAAAGATAGAGAACTTCAGACC 26951942

Query 3976 AATATCCTTGATGAACATTGAGGCAAAAATCCTCAATAAAACACTGGCAAAATGAATCCA 4035

Sbjct 26951941 AATTTCTCTTATGAACATCGATGCAAAAATCCTTAATAAAATTCTCGCTAACCGAATCCA 26951882

Query 4036 GCAGCACATCAAAAAGCTTATCCACCATGATCAAGTGGGCTTCATCCCTGGGATGCAAGG 4095

| |

Sbjct 26951881 AGAACACATTAAAGCAATCATCCATCCTGACCAAGTAGGTTTTATTCCAGGGATGCAGGG 26951822

Query 4096 CTGGTTCAATATACGCAAATCAATAAATGTAATCCAGCATAAAAACAGAGCCAAAGACAA 4155

|

Sbjct 26951821 ATGGTTTAATATACGAAAATCCATCAATGTAATCCATTATATAAACAAACTCAAAGACAA 26951762

Query 4156 AAACCACATGATTATCTCAATAGATGCAGAAAAAGCCTTTGACAAAATTCAACAACCCTT 4215

Sbjct 26951761 AAACCACATGATCATCTCGTTAGATGCAGAAAAAGCATTTGACAAGATCCAACACCCATT 26951702

Query 4216 CATGCTAAAAACTCTCAATAAATTAGGTATTGATGGGACGTATTTCAAAATAATAAGAGC 4275

| | |

Sbjct 26951701 CATGATAAAAGTTCTGGAAAGATCAGGAATTCAAGGCCAATACCTAAACATGATAAAAGC 26951642

Query 4276 TATCTATGACAAACCCACAGCCAATATCATACTGAATGGGCAAAAACTGGAAGCATTCTC 4335

| |

Sbjct 26951641 AATCTACAGCAAACCAGTAGCCAACATCAAAGTAAATGGAGAGAAGCTGGAAGCAATCCC 26951582

Query 4336 TTTGAAAACTGGCACAAGACAGGGATGCCCTCTCTCACCACTCCTATTCAACATAGTGTT 4395

| |

Sbjct 26951581 ACTAAAATCAGGGACTAGACAAGGCTGCCCACTTTCTCCCTACCTTTTCAACATAGTACT 26951522

Query 4396 GGAAGTTCTGGCCAGGGCAATTAGGCAGGAGAAGGAAATAAAGGGTATTCAATTAGGAAA 4455

|

Sbjct 26951521 TGAAGTATTAGCCAGAGCAATTCGACAACAAAAGGAGATCAAGGGGATACAAATTGGAAA 26951462

Query 4456 AGAGGAAGTCAAATTGTCCCTGTTTGCAGACGACATGATTGTATATCTAGAAAACCCCAT 4515

Sbjct 26951461 AGAGGAAGTCAAAATATCACTTTTTGCAGATGATATGATAGTATATATAAGTGACCCTAA 26951402

Query 4516 TGTCTCAGCCCAAAATCTCCTTAAGCTGATAAGCAACTTCAGCAAAGTCTCAGGATACAA 4575

| | |

Sbjct 26951401 AAATTCCAACAGAGAACTCCTAAACCTGATAAACAGCTTCGGTGAAGTAGCTGGATATAA 26951342

Query 4576 AATCAATGTACAAAAATCACAAGCATTCTTATACACCAACAACAGACAAACAGAGAGCCA 4635

| |

Sbjct 26951341 AATTAACTCAAACAAGTCAATGGCCTTTCTCTACACAAAGAATAAACAGGCTGAGAAAGA 26951282

Query 4636 AATCA-TGAGTGAACTCCCATTCACAATTGCTTCAAAGAGAATAAAATACCTAGGAATCC 4694

Sbjct 26951281 AATTAGGGAAACAACACCC-TTCTCAATAGCCACAAATAATATAAAATATCTCGGCGTGA 26951223

Query 4695 AACTTACAAGGGATGTGAAGGGCCTCTTCAAGGAGAACTACAAACCTCTGCTCAAGGAAA 4754

| | | |

Sbjct 26951222 CTCTAACGAAGGAAGTGAAAGATCTGTATGATAAAAACTTCAAGTCCCTGAAGAAAGAAA 26951163

Query 4755 TAAAAGAGGATACAAACAAATGGAAGAACATTCCATGCTCATGGGTAGGAAGAATCAATA 4814

| | | |

Sbjct 26951162 TTAAAGAAGATCTCAGAAGATGGAAAGATCTCCCATGCTCATGGATTGGCAGGACCAACA 26951103

Query 4815 TCGTGAAAATGGCCATACTCCTCAAGGTAATTTACAGATTCAATGCCATCCCCATCAAGC 4874

|

Sbjct 26951102 TTGTAAAAATGGCTATCTTGCCAAAAGCAATCTACAGATTCAATGCAATCCCCATTAAAA 26951043

Query 4875 TACCAATGACTTTCTTCACAGAACTGGAAAAAACTACTTTAAAGTTCATATGGAACCAAA 4934

| | | | | |

Sbjct 26951042 TTCCAACTCAATTCTTCAACGAATTAGAAGGAGCAATTTGCAAATTCATCTGGAATAACA 26950983

Query 4935 AGAGAGCCCACATCGCCAAGTCAATCCT--AAGCCAAAAGAACAAAGCTGGAGGCATCAC 4992

| | | |

Sbjct 26950982 AAAAACCGAGGATAGCAAAAACTCTTCTCAAGGATAAAAGAAC--CTCTGGTGGAATCAC 26950925

Query 4993 ACTACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGGTA 5052

Sbjct 26950924 CATGCCTGACCTAAAGCTTTACTACAGAGCAATTGTGATAAAAACTGCATGGTACTGGTA 26950865

Query 5053 CCAAAACAGAGATATTGATCAATGGAACAGAACAGGGCCCTCAGAAATAACGCCGCATAT 5112

| | | |

Sbjct 26950864 TAGAGACAGACAAGTGGACCAATGGAATAGAATTGAAGACCCAGAAATGAACCCACACAC 26950805

Query 5113 CTACAACTATCTGATCTTTGACAAACCTGACAAAAACAAGCAATGGGGAAAGGATTCCCT 5172

|

Sbjct 26950804 CTATGGTCACTTGATCTTCGACAAGGGAGCCAAAACCATCCAGTGGAAGAAAGACACCAT 26950745

Query 5173 ATTTAATAAATGGTGCTGGGAAAACTGGCTAGCCAT-ATGTAGAAAGCTGAAACTGGATC 5231

| | |

Sbjct 26950744 TTTCAACAATTGGTGCTGGCACAACTGG-TTGTTATCATGTAGAAGAATGCGAATCGATC 26950686

Query 5232 CCTTCCTTACACCTTATACAAAAATCAATTCAAGATGGATTAAAGAGTTAAACGTTAGAC 5291

| | | |

Sbjct 26950685 CATACTTATCTCCTTGTACTAAGGTCAAATCTAAGTGGATCAAGGAACTTCACATAAAAC 26950626

Query 5292 CTAAAACCATAAAAACCCTAGAAGAAAACGTAGGCATTACCATTCAGGACATAGGCATGG 5351

| |

Sbjct 26950625 CAGAGACACTGAAACTTATAGAGGAGAAAGTGGGGAAAAGCCTTGAAGATATGGGCACAG 26950566

Query 5352 GCAAGGACTTCATGTCTAAAACACCAAAAGCAATGGCAACAAAAGACAAAATTGACAAAT 5411

| |

Sbjct 26950565 GGGAAAAATTCCTGAACAGAACAGCAATGGCTTGTGCTGTAAGATCGAGAATTGACAAAT 26950506

Query 5412 GGGATCTAATTAAACTAAAGAGCTTCTGCACAGCAAAAGAAACT-ACCATCAGAGTGAAC 5470

| |

Sbjct 26950505 GGGACCTAATGAAACTCCAAAGTTTCTGCAAGGCAAAAGACACTGTCTATAAGA-CAAAA 26950447

Query 5471 AGGCAACCTACAAAATGGGAGAAAATTTTTGC--AACCTACTCATCTGACAAAGGGCTAA 5528

| | | | |

Sbjct 26950446 AGACCACCAACAGACTGGGAAAGGATCTTTACCTATCCTA--AATCAGATAGGGGACTAA 26950389

Query 5529 TATCCAGAATCTACAATGAACTCAAACAAATTTACAAGAAAAAAACAAACAACCCCATCA 5588

| |

Sbjct 26950388 TATCCAACATATATAAAGAACTCAAGAAGGTGGACCTCAGAAAATCAAATAACCCCCTTA 26950329

Query 5589 AAAAGTGGGTGAAGGACATGAACAGACACTTCTCA---AAAGAAGACATTTATGCAGCCA 5645

|

Sbjct 26950328 AAAAATGGGGCTCAGAACTGAACAAAGAATTCTCACCTGAGGAATAC-CGAATG--GCAG 26950272

Query 5646 ACAGACACATGAAAAAATGCTCATCATCACTGGCCATCAGAGAAATGCAAATCAAAACCA 5705

|

Sbjct 26950271 AGAAGCACCTGAAAAAATGTTCAACATCCTTAATCATCAGGGAAATGCAAATCAAAACAA 26950212

Query 5706 CAATGAGATACCATCTCACACCAGTTAGAATGGCGATCATTAAAAAGTCAGGAAACAACA 5765

Sbjct 26950211 CCCTGAGATTCCACCTCACACCAGTGAGAATGGCTAAGATCAAAAATTCAGGTGACAGCA 26950152

Query 5766 GGTGCTGGAGAGGATGTGGAGAAATAGGAACATTTTTACACTGTTGGTGGGACTGTAAAC 5825

| | |

Sbjct 26950151 GATGCTGGCGAGGATGTGGAGAAAGAGGAACACTCCTCCATTGTTGGTGGGATTGCAGGC 26950092

Query 5826 TAGTTCAACCATTGTGGAAGTCAGTGTGGCGATTCCTCAGGGATCTAGAACTGGAAATAC 5885

| | |

Sbjct 26950091 TTGTACAACCACTCTGGAAATCAGTCTGGCGGTTCCTCAGAAAATTGGACATAGTACTAC 26950032

Query 5886 CATTTGACCCAGCCATCCCATTACTGGGTATATACCCAAAGGACTATAAATCATGCTGCT 5945

| | |

Sbjct 26950031 CGGAGGATCCAGCAATACCTCTCCTGGGCATATATCCAGAAGA----AGCCCCAACTGGT 26949976

Query 5946 -ATAAAGACACATGCACACGTATGTTTATTGCGGCATTATTCACAATAGCAAAGACTTGG 6004

| | |

Sbjct 26949975 AAGAAGGACACATGCTCCACTATGTTCATAGCAGCCTTATTTATAATAGCCAGAAACTGG 26949916

Query 6005 AACCAACCCAAATGTCTAACAATGATAGACTGGATTAAGAAAATGTGGCACATATACACC 6064

|

Sbjct 26949915 AAAGAACCCAGATGCCCCTCAACAGAGGAATGGATACAGAAAATGTGGTACATCTACACA 26949856

Query 6065 ATGGAATACTATGCAGCCATAAAAAATGATGAGTTCATGTCCTTTGTAGGGACATGGATG 6124

|

Sbjct 26949855 ATGGAGTACTACTCAGCTATTAAAAAGAATGAATTTATGAAATTCCTAGCCAAATGGATG 26949796

Query 6125 AAATTGGAAATCATCATTCTCAGTAAACTATCGCAAGAACAAAAAACCAAACACCGCATA 6184

| | |

Sbjct 26949795 GACCTGGAGAGCATCATCCTGAGTGAGGTAACACAATCACAAAGGAACTCACACAATATG 26949736

Query 6185 TTCTCACTCATAGGTGG 6201

Sbjct 26949735 TACTCACTGATAAGTGG 26949719


(more in tomorrow's entry)

and that's not all.

So what does that mean? the sequence is a really, really common one at this level of identity? (Chr4 is the 4th, after equal similitude to parts of chr15 for example).

  • Heather 08:08, 1 August 2009 (EDT):
Personal tools