      <style type="text/css">

/* ====================

  主に全体に関わるCSS

　　　==================== */

      body {behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc);}

      .clear {clear:both;}

body.mediawiki {

                       font-size: 14px;

background-color:#707070; background-position: center center; background-attachment: fixed; background-repeat: no-repeat; font-family: Calibri, Verdana, helvetica, sans-serif; }

               h1 {
                       padding: 0px 20px 5px 20px;
                       font-size: 34px;
                       font-weight: bold;
               }
               h2 {
                       padding: 20px 20px 5px 20px;
                       font-size: 25px;
                       color: #0083eb;
                       text-decoration: none;
                       font-weight: bold;}
                       border: none;
               h2 a {
                       color: #eb8300;
               }
               h3 {
                       padding: 20px 20px 5px 20px;
                       font-size: 20px;
                       color: #000;
                       font-decoration: none;
                       font-weight: bold;
               }
               h1.firstHeading {

display: none;

p { text-align: justify; } a:link { color: #00a5ea; text-decoration: none } a:visited { color:#00a5ea; text-decoration: none } a:hover {

                       color: #eb8300;

text-decoration: none } a:active { color:#f29400; text-decoration: none } #bodyContent {

                       width: 970px;
                       margin: 0px 0px 0px;
                       background-color:#ffffff;
                       border-width: 0px 1px 0px 1px;
                       border-color: #000000;
               }
               #content {
                       padding-left: 0px; width: 970px;
               }

table#team_members {

                       text-align: justify;
                       border: 0;
               }

table#team_members h2, table#team_members h3 {

                       clear: both;
               }

#content * a:hover {

                       text-decoration:none;
               }

#main_wrapper {

                       position:absolute;
                       left:0px;
                       top:20px;

margin-top: 0; width: 969px; height: 221px; align: center; border-style: solid;

                       border-color: white;

} /* ====================

  メニューの画像を変更できる部分
  ==================== */

#header {

                       position:relative;
                       left:0px;
                       top:0px;

margin-top: 0; width: 969px; height: 221px; align: left; background-color: #FFFFFF;

                       background-image: url(http://openwetware.org/images/e/e0/NEW_header.jpg);

} /* ====================

  以下、特殊なclassに適用される
  ==================== */

#navigation { position:absolute;

                       left:18px; top:155px; width:1200px; height:69px;

z-index:100;

                       background-color: transparent;
                       float: left;

color: #0000FF; } #super_main_wrapper {

                       position:absolute;
                       left:0px;
                       top:227px;

width: 975px; align: center; background-color: #ede8e2;

                       heigth: auto;
               }
               #SubWrapper {
                       width: 645px;
                       padding: 0px;
                       border-left:4px solid #ede8e2;
                       float: left;
                       margin-top: 0px;
                       background-color: #ede8e2;
               }
               #SubWrapper * p, #SubWrapper p  {
                       padding: 0 20px;
                       text-align: justify;
                       font-size: 12px;
               }
               #SubWrapper * h3, #SubWrapper h3 {
                       padding-top: 10px;
                       font-size: 18px;
               }
               #news {
                       width: 322px;
                       margin-top: 0px;
                       float: left;
                       background-color: #d8d5d0;
                       border-right:4px solid #ede8e2;
               }
               #news p {
                       padding: 0 20px 20px 20px;
                       text-align: justify;
                       font-size: 12px;
               }
               #news h3 {
                       padding: 10px 20px;
                       font-size: 18px;
               }
               #mission_box {
                       width:650px;
                       float: left;
               }
               #team_box, #heartbeat_box, #notebook_box, #parts_box, #gallery_box, #sponsors_box, .boxy {
                       width:215px;
                       float: left;
                       padding: 10px 0 0 0;
               }
               div.tleft {
                       border-width: 0px;
                       margin:0;
                       padding:0;
                       border-color:transparent;
               }

/* ====================

  ここからプルダウン周辺のデザイン
  ==================== */

menu * {

margin: 0; padding: 0; }

menu {

behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc);  font-family: calibri, verdana, sans-serif;

       font-color: #ffffff;

font-size: 19px; background-color: transparent; float:left; padding: 12px 0 0 0; }

menu ul {

float: left; list-style: none; }

menu ul li {

background-color:transparent;

       position:relative;

float:left; list-style: none; padding: 10px 20px 0 0;

       font-weight: bold;
       width: auto;

}

menu a {

color: #FFFFFF; display: inline; text-decoration: none; }

menu a:visited {

color:#FFFFFF; text-decoration: none }

menu a:hover {

color: #00a5ea; }

menu ul li ul {

display: none; position: absolute; left: 0px;

       width: 155px;
       heigth: 1%;

font-size: 19px; opacity: 0.8; list-style: none;

       top: 30px;
       padding-top: 20px;
       z-index:500;

}

menu ul li:hover ul {

display: inline;

       background-position: bottom;

}

menu ul li ul li {

width: 100%; list-style: none;

       background-color: #000;
       margin: -1px;
       padding: 0px 0 0 5px;
       display: inline;

}

</style>

<!--[if IE]> <style type="text/css">

SubWrapper {width: 645px;}
news {width: 317px;}
super_main_wrapper {position:static;}
navigation {left: 15px;}
menu ul li ul {left: -2px; top: 22px;}

</style> <![endif]--> <div id="main_wrapper">

 <div id="header">

<div id="navigation"> <div id="menu" style="position:static"> <ul> <li><a class="aMain" href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo">Home</a></li> <li><a class="aTeam" href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Team/Students">Team</a></li> <li><a class="aProject" href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project">Project</a>  <li><font color="#ffffff">Results</font> <ul> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Results">Experiments</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Simulations">Simulations</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Achievements/DNA_Devices">DNA Design</a></li> </ul></li>  <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Achievements">Achievements</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Future_works">Future works</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Notebook/Protocols">Protocols</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Notebook/Lab.notebook">Notes</a></li> <li><a class="aNotebook" href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Sponsors/">Sponsors</a></li> <li><a class="aSitemap" href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Sitemap">Sitemap</a></li>

</ul> </div> </div>  </div> </div>  <script type="text/javascript">

/***********************************************

CSS Vertical List Menu- by JavaScript Kit (www.javascriptkit.com)
Menu interface credits: http://www.dynamicdrive.com/style/csslibrary/item/glossy-vertical-menu/
This notice must stay intact for usage
Visit JavaScript Kit at http://www.javascriptkit.com/ for this script and 100s more

- - - - /

var menuids=new Array("verticalmenu") //Enter id(s) of UL menus, separated by commas var submenuoffset=-2 //Offset of submenus from main menu. Default is -2 pixels.

function createcssmenu(){ for (var i=0; i<menuids.length; i++){

 var ultags=document.getElementById(menuids[i]).getElementsByTagName("ul")
   for (var t=0; t<ultags.length; t++){
   var spanref=document.createElement("span")

spanref.className="arrowdiv" spanref.innerHTML="  " ultags[t].parentNode.getElementsByTagName("a")[0].appendChild(spanref)

   ultags[t].parentNode.onmouseover=function(){
   this.getElementsByTagName("ul")[0].style.left=this.parentNode.offsetWidth+submenuoffset+"px"
   this.getElementsByTagName("ul")[0].style.display="block"
   }
   ultags[t].parentNode.onmouseout=function(){
   this.getElementsByTagName("ul")[0].style.display="none"
   }
   }
 }

} if (window.addEventListener) window.addEventListener("load", createcssmenu, false) else if (window.attachEvent) window.attachEvent("onload", createcssmenu) </script>  </html>

Light-irradiated gathering mode

In the light-irradiated gathering mode, DNA ciliates gather at a specific area responding to UV irradiation. This mode is achieved by UV-switching DNA devices and observation of gathering DNA ciliates.

The UV-switching DNA device has the stem-loop structure which has UV-responsive bases, azobenzenes. Before UV-irradiattion, this DNA device doesn’t trap deoxyribozyme legs of DNA ciliate. After UV irradiation, azobenzenes are isomerized and the DNA device traps deoxyribozyme legs of DNA ciliate. By this reaction, DNA ciliates gather at UV-irradiated area. By using this system, we think DNA’s movement can be controlled.

Mechanism

UV-switching system

Deoxyribozyme, blocking DNA, and UV-switching DNA are used in this system. The UV-switching DNA hybridizes with blocking DNA and DNA ciliate’s deoxyribozyme legs doesn’t hybridize. This structure is closed state. By UV irradiation, the stem-loop of UV-switching DNA becomes open and branch migration starts, so DNA ciliate’s deoxyribozyme legs become trapped by UV-switching-DNA. This structure is open state.

UV-switching DNA has a stem-loop structure which contains two azobenzenes. By spotting UV, azobenzenes are isomerized and this loop becomes open. This opened loop has a complementary part for deoxyribozyme. This UV-switching DNA is complimentary for blocking DNA.

Sequence design

[UV-switching DNA]

5' -(NH2)-TTTTTT TTTTCACTATTTCGACCGGCTCGGAGAAGAG TTTTT CT X CT X TC-3' (X means azobenzene. )
Size: 48bases + 2azobenzenes
- UV-switching DNA is used for the scaffold in light-irradiated gathering mode. We designed this DNA by ourselves. UV-switching DNA has a five bases’ loop (TTTTT) and there are two azobenzenes (X) in the one side of the stem (CTXCTXCT).
- By spotting UV, azobenzenes are isomerized (trans to cis), so the part which contains azobenzenes becomes hard to form double strand. It is known that UV-switching can be realized by using this principle. (ref)
- To achieve this switching, it is necessary to design the stem which forms the loop firmly in the room temperature and opens the loop by isomerizing of two azobenzenes. We didn’t find the precedent which succeeded in opening and closing at a single molecular by azobenzenes which are inserted into a stem, so the designing is very difficult. After trial and error, we designed to use “GAAGAG” and “CTXCTXCT” as the stem and “TTTTT” as the loop.
- The 7th to 37th bases from 5' end (TTTTCACTATTTCGACCGGCTCGGAGAAGAG) is a complete complementary part for the deoxyribozyme. In addition, the 7th to 31th bases from 5’ end (TTTTCACTATTTCGACCGGCTCGGA) are a complementary part for blocking DNA. Consequently, the 32th to 37th bases from 5’ end (GAAGAG) are a complementary part for deoxyriboyme and not a complementary part for blocking DNA, so branch migration is started from this part and blocking DNA is released. Moreover, these 6 bases are a part which makes stem, so this part is blocked when the loop is closed. By this structure, branch migration doesn’t happen when the loop is formed.
- We designed the first 6 bases from 5' end as a linker (TTTTTT). This is also designed not to make unexpected structures. As a result, we decide using this linker.
- The 5' end is aminated to be fixed on a glass plate.

[Blocking DNA]

5' -TCCGAGCCGGTCGAAATAGTGAAAA-3'
Size: 25bases
- Blocking DNA is the DNA which hybridizes with UV-switching DNA and prevent hybridization between deoxyrobozyme and UV-switching DNA.
- Blocking DNA is complimentary to UV-switching DNA segment which is the 7th to 31th bases from 5' end (TTTTCACTATTTCGACCGGCTCGGA).
- Blocking DNA’s arrangement is equal to a part of deoxyribozyme. The part is 25 bases from deoxyribozyme’s 3’ end. However, the blocking DNA doesn’t have deoxyribozyme activity because this DNA doesn’t have 6 bases which need for deoxyribozyme activity. Accordingly, in the future, if both substrate and UV-switching DNA are attached, released blocking DNA doesn’t cleave substrate.

Biomod/2011/TeamJapan/Tokyo/Project/Model of the light irradiated gathering mode

Light-irradiated gathering mode

Mechanism

UV-switching system

Sequence design

[UV-switching DNA]

[Blocking DNA]

Navigation menu

Page actions

Page actions

Personal tools

Navigation

Search

research

Tools