Biomod/2011/TeamJapan/Tokyo/Project/Model of the DNA ciliate body

From OpenWetWare

Jump to: navigation, search










Model of the DNA ciliate body

Introduction

To create DNA ciliate, a micrometer-sized body and its motor are indispensable. We chose DNA as a material for the motor because DNA is the most suitable material that is nanometer-sized and easy to be attached to micrometer-sized objects by various surface modifications. The micrometer-sized body is required to be micrometer-sized, homogeneous, and easy to attach DNA. We use micrometer-sized polystyrene beads as the micrometer-sized bodies because their forms are homogeneous and their carboxylic acid is useful for attaching molecular.
We use two methods to attach DNA to polystyrene beads. In both methods, we bind polystyrene beads' carboxylic acid to amino group of aminated DNA. In first method, we apply reference [1]. In this method, we used linker between polystyrene beads and aminated DNAs. The linker has amino group and carboxylic acid. The linker’s amino group combines with carboxylic acid of polystyrene beads and the linker’s carboxyric acid combines with amino group of aminated DNA, so polystyrene beads combine DNA through the linker. In second method, we use NHS and EDC to alter carboxylic acid to NHS. NHS has very high reactivity, and DNA's amino group reacts with NHS of porystyrene beads. The DNA ciliate body is developed in this process. :
As a motor of DNA ciliate, we used deoxyribozyme which is the enzyme comprised of DNA. Deoxyribozyme cleaves its substrate at an RNA base, if there are 2+ metal ions. Using this reaction, DNA ciliate can move.

Principle and methods

  • Two experiments were needed to complete developing DNA ciliate body.
    First experiment was creating DNA ciliate by attaching DNAs to polystyrene beads. This process is used the reaction of connecting aminated DNAs’ amino group and polystyrene beads’ carboxylic acid. We took two methods to react. Both methods are used the common reaction, but chemical materials are different. First method is used EDC and NHS. This induces transforming carboxylic acid to succinimide which is been able to react with aminated DNAs and connect.
Figure1.the result of PAGE of φ200 nm polystyrene beads using NHS and EDC.
Second method is used EDAC. EDAC reacts with both aminated DNAs and polystyrene beads’ carboxylic acid.
Figure1.the result of PAGE of φ200 nm polystyrene beads using NHS and EDC.

Second experiment is confirming whether deoxyribozyme is attached to polystyrene beads and able to cleave substrate. We confirm deoxyribozyme activity by urea-PAGE. Making mixture of DNA ciliate and substrate and Zn2+ ions. If DNA ciliate has deoxyribozyme activity, substrate is cleaved and the band of cleaved substrate appears as a band.

Sequence design

[Deoxyribozyme]

Simplified image of deoxyribozyme
Simplified image of deoxyribozyme
  • 5' -(NH2)-TTATTATTAT CTCTTCTCCGAGCCGGTCGAAATAGTGAAAA-3'
  • Size: 41bases
    • This DNA is the only DNA which is attached to DNA ciliate body. This has enzyme activity for substrate. The 31bases from 3' end of the strand1 are act as a deoxyribozyme when it hybridizes with the substrate. Those 31bases are same to the DNA spider's leg(CTCTTCTCCGAGCCGGTCGAAATAGTGAAAA).
    • We designed by ourselves the first 10 bases from 5’ end as a linker between a substrate and a polystyrene bead (TTATTATTAT). Thanks to this linker, the space between DNA ciliate body and deoxyribozyme’s enzyme activity area is appeared, so deoxyribozyme can easily hybridize with other DNAs. The linker shouldn’t hybridize with other DNAs and make unexpected structure, so we also took care of these things. We designed linker which doesn’t make dimer and unexpected inner structure. In addition, we don’t use guanine and cytosine because these bases are easy to make nonspecific dimer. We select some strands as the candidates for linkers. As a result, we decide to use “TTATTATTAT” as a linker.
Personal tools