BME103 s2013:T900 Group7 L3

From OpenWetWare

Jump to: navigation, search
BME 103 Spring 2013 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png

Contents

OUR TEAM

Name: Amanda SeaneyProtocol Planner
Name: Amanda Seaney
Protocol Planner
Name: Carissa HenriksenProtocol Planners
Name: Carissa Henriksen
Protocol Planners
Name: Tanya SinghOpen PCR Engineer
Name: Tanya Singh
Open PCR Engineer
Name: Samantha BarkerResearch and Development Scientists(s)
Name: Samantha Barker
Research and Development Scientists(s)
Name:Nathan ScheuerMachine Engineer
Name:Nathan Scheuer
Machine Engineer

LAB 3 WRITE-UP

Original System: PCR Results

PCR Test Results

Sample Name Ave. INTDEN* Calculated μg/mL Conclusion (pos/neg)
Positive Control 1192265.33 --- N/A
Negative Control 74840.5 --- N/A
Tube Label: B Patient ID: 43825 rep 1 305749.66 --- neg
Tube Label: C Patient ID: 43825 rep 2 182268 --- neg
Tube Label: D Patient ID: 43825 rep 3 52784.66 --- neg
Tube Label: F Patient ID: 12079 rep 1 1292454 --- pos
Tube Label: G Patient ID: 12079 rep 2 147254.66 --- pos
Tube Label: H Patient ID: 12079 rep 3 1386378 --- pos

* Ave. INTDEN = Average of ImageJ integrated density values from three Fluorimeter images


Bayesian Statistics
These following conditional statistics are based upon all of the DNA detection system results that were obtained in the PCR lab for 20 hypothetical patients who were diagnosed as either having cancer or not having cancer.

Bayes Theorem equation: P(A|B) = P(B|A) * P(A) / P(B)


Calculation 1: The probability that the sample actually has the cancer DNA sequence, given a positive diagnostic signal.

  • A = P of positive cancer sequence = 9/20 = .450
  • B = P of positive diagnostic signal = 26/60 = .430
  • P (B|A) = P of a positive diagnostic signal given that the sample actually has the cancer DNA sequence = 21/24 = .875
  • P(A|B) = .916=91.6%


Calculation 2: The probability that the sample actually has a non-cancer DNA sequence, given a negative diagnostic signal.

  • A = P of negative cancer sequence = 11/20 = .550
  • B = P of negative diagnostic signal = 34/60 = .567
  • P (B|A) = P of a negative diagnostic signal given that the sample actually has the caner DNA sequence = 29/31 = .935
  • P(A|B) = .907=90.7%


Calculation 3: The probability that the patient will develop cancer, given a cancer DNA sequence.

  • A = P of positive cancer diagnostic = 7/20 = .350
  • B = P of positive conclusion = 9/20 = .450
  • P (B|A) = P of positive conclusion given that the sample actually gives a positive cancer diagnostic = 6/7 = .857
  • P(A|B) = .667=66.7%


Calculation 4: The probability that the patient will not develop cancer, given a non-cancer DNA sequence.

  • A = Probability of negative cancer diagnostic = 13/20 = .650
  • B = Probability of negative conclusion = 11/20 = .550
  • P (B|A) = Probability of positive conclusion given that the sample actually gives a positive cancer diagnostic = 10/13 = .769
  • P(A|B) = .909=90.9%


New System: Design Strategy

The Gotta Have:

  • The new PCR machine must have results that are easy to determine. In order to reduce the time it takes to find a result and make a conclusion, we will develop a touch screen application that gives a complete, detailed analysis of the DNA Florometer data. The touch screen can show the fluoresence levels of all the samples in the machine and make a logical conclusion of the DNA samples.
  • The new PCR machine also must have simple OpenPCR software. This part of the process was very efficient in the current system, even though it was downloaded onto a separate computer, this was able to make the machine run more efficiently, and this software is included in the touch screen feature of the PCR machine; but it is still accessibly downloadable to a computer.


The Want:

  • For the new PCR machine, a want for the system would be accessibly being able to fix the machine when it works. Although this would be helpful and efficient, it is not a need of the product. When the product fails it can be sent to the company with out much hassle.
  • Another want of the product would be the product being portable and compact. This will allow for our target market, classroom environments and doctors offices, to get the most use out of the product while it being efficient and convenient.


The Must Not Have:

  • A must not have for this product would definitely be the imaging process being manual. The problem with the imaging being manual is that it takes a lot of time and effort to finally receive results. If patients or students are waiting for their PCR results, it would be very inconvenient and waste of time if the process of florimetry took so long because it was all manual.
  • Another must not have for the PCR machine is having an easy way to mix drops during imaging. It is an easy way to lead to cross contamination. This could lead to serious problems when it comes down to the florimetry steps of the PCR process. It could be concluded that a patient does in fact have the gene when they actually don't; or even worse, a patient could come up negative when they actually are at risk of developing cancer.


The Should Avoid:

  • The things that should be avoided include the open PCR machine being fragile. Since one of our key features is the machine being portable, the likelihood of someone dropping the machine or it falling of a table is more likely. To ensure that the machine isn't damaged enough for company repair, it can't be extremely fragile. The wooden casing does a pretty good job to prevent it from being extremely fragile.
  • The other thing that should be avoided is slow analysis. This ties into the time commitment issue stated above. It takes a lot of time to analyze each DNA sample. It takes even longer to find the florescence level of the DNA sample. Since our target market is doctors offices and schools that are on a schedule, it is critical that the PCR process remain timely and efficient.




New System: Machine/ Device Engineering

SYSTEM DESIGN


KEY FEATURES

These are the new features of the system


Our new and improved PCR machine will be an all-in-one system encompassing the process of PCR, fluorimeter imaging, and image analysis. The results of the system will be displayed on screen after the testing is completed. Having an all in one system increases the machines ease of use as it does not require any additional machinery in order to operate.

The LED screen of the old open PCR system will replaced with a standard touchscreen display. From this screen the user can interact with the built in software needed to calibrate the PCR process. The display is simple to use and will walk the user through a step by step process of running the machine. The results of the tests will be displayed here as well as real-time updates and time estimation.

Because the new design is all inclusive there is no need to remove the DNA from the machine throughout the entire process. The test tube holding tray of the old open PCR system (image on the right) will be replaced by a tray that will hold the test tubes like a rack allowing them to hang freely. This will not only allow for better (faster) heating/cooling, but will allow for the fluorimeter analysis to be done without removing the DNA from the system. After the user adds the SYBR green to each DNA sample in the test tubes, the system will automatically shine a laser through the clear test tubes and cause the DNA samples to become florescent. A built in camera will image each sample of the florescent DNA.

The built in imageJ software will then automatically analysis these images and determine the ultimate results of the test. A detailed copy of the testing can be downloaded from the device and imported to any computer for a more detailed understand of the tests that were run as well as any errors that may have occured.

The size of the device will remain relatively similar, however the parts of the old system would be replaced with more durable parts such as hard plastic or metal instead of wood. In order to increase the mobility of the system an optional battery pack would be available.


INSTRUCTIONS

1. Turn on the machine and click calibrate. Enter the correct setting for which you would like the machine to run during the PCR phase.

2. Open the lid a place the DNA samples (in clear test tubes) on the hanging rack. Close the lid and press run on the screen. The screen will give a time estimation for the PCR phase.

3. After the PCR phase, open the lip and add an appropiate amount of SYBR Green to EACH DNA sample. Close the lid

4. Enter the desired number of sample images to be taken for analysis and press run. The system will automatically take pictures and analyze them. The results will be displayed on the screen. The time for this process depends on the amount of samples desired.

5. After the images have been analyzed the results will be displayed on screen. From here the user can opt to export the detailed results to a flash drive via a usb port in the system.





New System: Protocols

DESIGN

We chose to include these new approaches/ features

  • Feature 1 - Our new design will have everything in one machine so that it increases its ease in use. The new system will automatically conduct the amplification and measure the fluoresence.
  • Feature 2 - The new design includes a LED screen that automatically displays the result of the DNA that was put into the machine. This will reduce the amount of time that the entire PCR process takes, which will allow for the machine to be efficient and used in a timely manner. It will also allow for the product to be easily portable and compact because there will be only the machine needed rather than other add-ons.
  • Feature 3- The new design will not require the user to take a picture of the sample, because the system will automatically take a picture and analyze the sample. Instead of putting the sample on a slide to take a picture of it, the machine will simply add the SYBR Green to the clear tube where the DNA reaction sample is, and take a picture to analyze the fluorescence of the sample. Again, this will reduce the amount of time it takes to get through the entire PCR process.



MATERIALS Solutions Used for Calibration

Supplied in the Kit
Camera
Data Analysis
Reaction
Reaction Mix (NaCl, MgSO, etc.)
Optional Battery/Electric
Computer Software
Supplied by User
Data Sample (2.5μL per tube)
Distilled Water
Negative and Positive Controls
Primers (1 μL froward and 1 μL backward)
SYBR Green


PROTOCOLS

  • PCR and DNA Measurement and Analysis Protocol
  1. Make sure that there are enough materials for the reaction mix in the various locations.
  2. Place 2.5 μL of positive and 2.5 μL of negative samples into machine.
  3. Place pre-ordered primers into machine. (1 μL for each primer)
  4. Place 2.5 μL of DNA sample into specified location in a clear container.
  5. After an hour has passed, one's results will show on the LED screen.



New System: Research and Development

BACKGROUND
The CHEK2 Gene, which stands for the checkpoint kinase 2, is a gene sequence found in the human genome that is one of the known cancer-coding sequences. The SNP for CHEK2 is rs17879961. The function of the CHEK2 gene is the protein encoding gene that is a cell cycle checkpoint regulator and tumor suppressor. It is the gene that detects DNA damage and prevents the cell from multiplying. The normal allele sequence for the gene is ATT, but with the cancer-associated allele the sequence becomes ACT.

DESIGN


Primers for PCR

The normal allele sequence for the gene is ATT, but with the cancer-associated allele the sequence becomes ACT. In order to create a primer for this gene sequence, a forward primer must be designed in order for it to bind with the ATT sequence on the DNA sample. The normal forward allele primer would be 5' TATGTATGCAATGTAAGAGTT 3'while the normal reverse primer would be 5'TGAACCACTGCTGAAAAGAAC 3'. This would allow for the DNA in the PCR machine to be duplicated both forwards and backwards. However, in order to find an exponential growth of DNA duplication used to determine if a cancer sequence is present, the cancer forward primer would instead be 5' TATGTATGCAGTGTAAGAGTT 3'and the cancer reverse allele would be 5'TGAACCACTGCTGAAAAGAAC 3'.
From using the cancer primers, a patients' DNA would create an exponential growth if the CHEK2 gene was in fact mutated from ATT to ACT. This is proven because the primer only binds to the DNA that matches directly with the primer, and since the cancerous sequence primer was used, the only exponential replication of DNA would result in a positive cancer conclusion. This can then be seen when the SYBR Green dye is added to the solution and it has a high florescent level. It can work in the same way for a non-diseased allele because if the primer does not match base by base to the patient's DNA, it will not duplicate. With no duplication there will be nothing for the SYBR Green dye to bind too; Thus, no cancer gene present.


Our primers address the following design needs

  • Due to the fact that our design strategies do not have to do with the gene primer used in the PCR machine, the primer doesn't address any of the design needs we are changing for the product. The CHEK2 gene is the same throughout the human genome and those needs no change for the DNA duplication to occur when the cancer gene mutation is present.




Personal tools