BME100 s2016:Group7 W1030AM L4

From OpenWetWare

Jump to: navigation, search
BME 100 Spring 2016 Home
People
Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3
Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png


Contents

OUR TEAM

Name: Ryan MasayesvaRole(s)
Name: Ryan Masayesva
Role(s)
Name: Milan PatelRole(s)
Name: Milan Patel
Role(s)
Name: studentRole(s)
Name: student
Role(s)
Name: studentRole(s)
Name: student
Role(s)
Name: studentRole(s)
Name: student
Role(s)
Name: studentRole(s)
Name: student
Role(s)

LAB 4 WRITE-UP

Protocol

Materials

  • Lab coat and disposable gloves
  • PCR reaction mix, 8 tubes, 50 μL each: Mix contains Taq DNA polymerase, MgCl2, and dNTP’s (http://www.promega.com/resources/protocols/product­information­sheets/g/gotaq­colorless­master­mix­m714-protocol/)
  • DNA/ primer mix, 8 tubes, 50 μL each: Each mix contains a different template DNA. All tubes have the same forward primer and reverse primer
  • A strip of empty PCR tubes
  • Disposable pipette tips: only use each only once. Never re­use disposable pipette tips or samples will be cross­contaminated
  • Cup for discarded tips
  • Micropipettor
  • OpenPCR machine: shared by two groups


PCR Reaction Sample List

Tube Label PCR Reaction Sample Patient ID
G7 + Positive control none
G7 - Negative control none
G7 1-1 Patient 1, replicate 1 56256
G7 1-2 Patient 1, replicate 2 56256
G7 1-3 Patient 1, replicate 3 56256
G7 2-1 Patient 2, replicate 1 98031
G7 2-2 Patient 2, replicate 2 98031
G7 2-3 Patient 2, replicate 3 98031


DNA Sample Set-up Procedure

  1. Step 1: Take PCR tube and place on ice.
  2. Step 2: Extract DNA from source and place in source tube. Put tube in tube strip.
  3. Step 3: Transfer DNA source from sample tube to PCR tube using micropippete. (Make sure to use a fresh tip each time you use a micropippete, or else you could risk cross contaminating the sample.)
  4. Step 4: Transfer DNA primer mix to PCR tube using micropippete.
  5. Step 5: Transfer PCR reaction mix to PCR tube using micropippete.
  6. Step 6: Make sure contents are mixed by gently swirling the closed PCR tube in your hand
  7. Step 7: Take PCR tube and put in the OpenPCR machine and let it run it's cycle.


OpenPCR program

  • Heated Lid: 100°C
  • Initial Step: 95°C for 2 minutes
  • Number of Cycles: 25
  • Denature at 95°C for 30 seconds, Anneal at 57°C for 30 seconds, and
  • Extend at 72°C for 30 seconds
  • Final Step: 72°C for 2 minutes
  • Final Hold: 4°C





Research and Development

PCR - The Underlying Technology

PCR Reaction Components
There are four main components that are essential to the PCR reaction process. These include a template DNA, primers, taq polymerase, and deoxyribonucleotides. Template DNA is important for the reaction process because it is the piece of DNA that is going to be replicated by acting as a template for the primers and polymerase to work on. Primers are short strands of DNA that are complementary to the template DNA. This allows taq polymerase to have a position to start adding nucleotides to in order to replicate the complementary strand. Taq polymerase is an enzyme that is derived from a bacteria found in high temperature environments. This allows the enzyme to not become denatured during the high temperatures that occur in a PCR reaction. Taq polymerase helps add deoxyribonucleotides to the DNA strand in order to replicate it properly. Deoxyribonucleotides consist of deoxyadenosine, deoxyguanosine, deoxythymidine, and deoxycytidine. These are the monomers that are added to the primers on the template DNA by taq polymerase in order to complete the complementary strand.


Thermal Cycling Steps
During the initial step of the PCR reaction, the thermocycler heats up to 95°C for 3 minutes. The DNA is then denatured at this temperature for 30 seconds. This allows the DNA double helix to unwind and separate into two single stranded DNA molecules. The thermocycler then cools down to 57°C for 30 seconds where the primers attach to their target sequence before the strands can join back together. The thermocycler then heats back up to 72°C where taq polymerase can attach to the primers and add the complementary nucleotides to complete the strand. This step lasts for 3 minutes to ensure that the entire strand is completed. The temperature is then set to 4°C for short term storage of the reaction. The four nucleotides that are attached to the DNA template are Adenine, Thymine, Cytosine, and Guanine. Adenine binds to Thymine while Cytosine binds to Guanine. The two steps of thermal cycling in which the base-pairing occurs is during the annealing and extension step. During the annealing step, the primers are attached to the complementary strand. For the extension step, the nucleotides are paired to the DNA template by taq polymerase.




Question #3
Adenine anneals to Thymine, and Thymine to Adenine. Cytosine anneals to Guanine, and Guanine to Cytosine.
Question #4
Base pairing occurs during the annealing section of pcr, becausr that's when the polymerase takes the DNA nucleotides and binds them to their corresponding positions on the base strand.

SNP Information & Primer Design

Background: About the Disease SNP SNP is single-nucleotide polymorphism. It's where a single nucleotide in the genome is changed from it's normal code. The single nucelotide changed can cause changes in amino acid coding and protein folding. When this happens the DNA is changed and the individual may be more susceptible to certain diseases, like sickle cell or Alzheimer's. We can look the genome sites where these susceptibilities occur and determine if an individual is more likely to get a certain disease.

Primer Design and Testing Part.1 1.A nucleotide is the basic form to create a DNA blocks. 2.A polymorphism is a programming language that is used to analyze different types of objects depending on the data collected relatively.

3.Human; Homo sapiens

4. Genomic 5.NA 6. single nucleotide variation 7. genes associated with immunity and inflammation and risk of NHL


Part.2 1.( citation: http://www.ncbi.nlm.nih.gov/gene/84002 ) : beta-1,3-N-acetylglucosaminyltransferase 5

2. Function Evidence Code Pubs beta-galactosyl-N-acetylglucosaminylgalactosylglucosyl-ceramide beta-1,3-acetylglucosaminyltransferase activity IDA PubMed  galactosyltransferase activity IEA   lactosylceramide 1,3-N-acetyl-beta-D-glucosaminyltransferase activity IEA   (citation: http://www.ncbi.nlm.nih.gov/gene/84002#general-gene-info )

3. An allele is a variant form of a gene (citation: http://www.nature.com/scitable/definition/allele-48 )


4. CAC

5. 17811986

6. GTGCGGGCTCCATCGCAACG

7. 17812186

8. GGAGGAAGGTGTCGCCCCTT

9. GTGCGGGCTCCATCGCAACA

   GGAGGAAGGTGTCGCCCCTT




Personal tools