BME100 s2015:Group3 12pmL5

From OpenWetWare

Jump to: navigation, search
BME 100 Spring 2015 Home
People
Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3
Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png


Contents

OUR TEAM

Name: Abraham Rosengard
Name: Abraham Rosengard
Name: Juan Patterson
Name: Juan Patterson
Name: Gabriella Leiva-Hidalgo
Name: Gabriella Leiva-Hidalgo
Name: Jessica Resendiz
Name: Jessica Resendiz
Name: Raghad Tamim
Name: Raghad Tamim
]


LAB 5 WRITE-UP

Procedure

Smart Phone Camera Settings

  • Type of Smartphone: iPhone 5
    • Flash: OFF
    • ISO setting: NON-ADJUSTABLE
    • White Balance: NON-ADJUSTABLE
    • Exposure:NON-ADJUSTABLE
    • Saturation:NON-ADJUSTABLE
    • Contrast:NON-ADJUSTABLE


Calibration

  1. Turn on the Fluorimeter and place the glass slide inside of it with the smooth side down
  2. Place the smart phone on the cradle at a distance greater than 4 cm from the Fluorimeter and set the camera for 3 seconds.Also adjust height of the Fluorimeter in order to make sure it is aligned with the camera.
  • Distance between the smart phone cradle and drop = 8 CM


Solutions Used for Calibration

Calibration with 5 units of DNA per microliter Image: dfslkfadjlfadslfdslkadsdfgdfgdfa.jpg Calibration with 2 units of DNA per microliter Image: treedcvfgbnhyujj.jpg
Calibration with 1 units of DNA per microliter Image: zaqwsxcderrfvbgtt.jpg Calibration with 0.5 units of DNA per microliter Image: gtrfvcderfvbgtyhnbg.jpg
Calibration with 0.25 units of DNA per microliter Image: zasdffghhnbvvcde.jpg Calibration with Water

Image: mjuyhnbgttrrfvcde.jpg



Placing Samples onto the Fluorimeter

  1. Turn on the Fluorimeter and place the glass slide inside of it with the smooth side down
  2. Place the smart phone on the cradle at a distance greater than 4 cm from the Fluorimeter and set the camera for 3 seconds.Also adjust height of the Fluorimeter in order to make sure it is aligned with the camera.
  3. Pipette 80 µL of SYBR Green I solution onto the glass slide, and place the drop between two of the circles vertically.
  4. [ Place 80 µL of the sample calibration solution on top of the drop from step 3, adjust the slide so that the blue light is going through the middle of the now larger drop.
  5. Make sure the camera of the phone is focused on the drop, if not adjust it, it cannot be closer than 4cm from the drop
  6. Cover the system with the black box, but make sure the camera is focused
  7. Press the camera button to take the picture making sure that there is enough time for the flap to be lowered
  8. Remove the 160 µL from the slide and place it in the waste container
  9. Move the slide to the next position and repeat these steps


Data Analysis

Representative Images of Negative and Positive Samples

Positive Control

Image: zasdbvvcde.jpg

Negative Control

Image: zafghhnbvvcde.jpg


Image J Values for All Calibrator Samples


Image: zafghhdggdfrdfgnbvvcde.jpg

Image: zafrfdggfdgdfghhnbvvcde.jpg


Calibration curve

Image: zafgasdasdhhnbvvcde.jpg

Note: Our camera was not sensitive enough to capture the high concentrations of SYBR green. Here is another graph with a more accurate trend line.

Image: zafgasddfjkasdhhnbvvcde.jpg

More Accurate Trend Line: y = 1348361.943 x + 305395.4

PCR Results Summary

  • Our positive control PCR result was 0.5989 μg/mL
  • Our negative control PCR result was 1.076 μg/mL (This is perplexing, and probably inaccurate, because the positive control is green in the picture above and the negative control is not green.)

Observed results

  • Patient 11553 : The pictures from this patient appeared a little green while the μg/mL value is close to 0.5 (the average sample value totaled 0.463 μg/mL).
  • Patient 91905: The pictures from this patient did not appear green and the μg/mL value is marginally close to 0 (the average sample value totaled 0.0619 μg/mL).

Conclusions

  • Patient 11553 tested positive: The y-values from the samples are approximately 1,000,000 while the value of the positive control is 1,100,000.
  • Patient 91905 tested negative: (Assuming the value for μg/mL of the negative control is incorrect and should be closer to 0) the y-values of this patient were significantly lower and did not contain that much green.




SNP Information & Primer Design

Background: About the Disease SNP


The SNP disease is found in Homo sapiens and is linked to the chromosome 8:19956018. The clinical significance of the SNP disease is that pathogenic mutations are possible and can damage the Homo sapien with this mutation. SNP is associated with the LPL (lipoprotein lipase) gene and linked to metabolic syndrome and coronary heart disease. A few of the many functions of the Lipoprotein Lipase gene are Apolipoprotein Binding, Heparin Binding, and Lipoprotein Lipase Activity. An allele is one of two or more alternative forms of a gene that arise by mutation and are found at the same place of the chromosome. A polymorphism occurs when two or more clearly different phenotypes exists in the same population of a species occurs when two or more clearly different phenotypes exists in the same population of a species.A polymorphism can result in an allele. The polymorphism which can result in this allele is AGT. The numerical position of SNP is 19956018. The normal non-diseased chromosome of an individual not containing this diseased allele is 5’ - AATCTGGGCTATGAGATCAA. The mutation of an A to a G results in a diseased gene that is linked with coronary heart disease.


Primer Design and Testing

Once tested the diseased primer was found to have the mutation, AGT, within the genetic code. There were no results for the nondiseased primers.

The numerical position of the SNP is: 19956018

Non-disease forward primer (20 nt): 5’- AATCTGGGCTATGAGATCAA

Numerical position 200 bases to the right of the disease SNP: 19956218

Non-disease reverse primer (20 nt): 5’- GAAACACCAGGGCTCAGGGT __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __

Disease forward primer (20 nt): 5’- AATCTGGGCTATGAGATCAC

Disease reverse primer (20 nt): 5’- TTAGACCCGATACTCTAGTG



Personal tools