PCR reaction mix, 8 tubes, 50 μL each: Mix contains Taq DNA polymerase, MgCl 2, and dNTP’s
DNA/ primer mix, 8 tubes, 50 μL each: Each mix contains a different template DNA. All tubes
have the same forward primer and reverse primer
A strip of empty PCR tubes
Disposable pipette tips: only use each only once. Never reuse disposable pipette tips . If you
do, the samples will become cross-contaminated
Cup for discarded tips
Micropipettor
OpenPCR machine: shared by two groups
PCR Reaction Sample List
Tube Label
PCR Reaction Sample
Patient ID
G# +
Positive control
none
G# -
Negative control
none
G# 1-1
Patient 1, replicate 1
18158
G# 1-2
Patient 1, replicate 2
18158
G# 1-3
Patient 1, replicate 3
18158
G# 2-1
Patient 2, replicate 1
76712
G# 2-2
Patient 2, replicate 2
76712
G# 2-3
Patient 2, replicate 3
76712
DNA Sample Set-up Procedure
Step 1
Step 2
Step 3...
OpenPCR program
Heated Lid: 100°C
Initial Step: 95°C for 2 minutes
Number of Cycles: 25
Denature at 95°C for 30 seconds, Anneal at 57°C for 30 seconds, and Extend at 72°C for 30 seconds*
Final Step: 72°C for 2 minutes
Final Hold: 4°C
INITIAL STEP: 95℃ for 3 minutes:
The DNA is heated
Denature at 95℃ for 3 minutes:
The DNA double helix separates, creating two single stranded DNA molecules
Anneal at 57°C for 30 seconds:
Primers bind to complementary matches to DNA sequences
Extend at 72°C for 30 seconds:
DNA polymerase locates a primer on the DNA strand and begins to add complementary nucleotides
FINAL STEP: 72°C for 3 minutes:
DNA polymerase continues until it gets to the end of the strand and falls off
FINAL HOLD: 4°C:
DNA polymerase is limited so that non-specific binding of primers and amplification of the sites is prevented
Research and Development
PCR - The Underlying Technology
Summary:
SNP is a disease that there is still controversy on whether it is pathogenic or benign. However, most research shows that it is indeed benign. The disease comes in the form of cardiac arrhythmia or Long QT Syndrome. This variation is found in humans only (Homo sapienss). SNP affects the human genome that it affects is chromosome 4.
Template DNA
The strand of DNA acts as template to be copied into mRNA and then translated
Primers
Attach to sites on a DNA strand that are at either end of the segment that you want to copy
TAQ Polymerase
Copy a cell’s DNA before it divides
Deoxyribonucleotides(dNTP’s):
Supports the replication of mitochondrial DNA
Question 3: Which base anneals to which?
Adenine (A):T
Thymine (T):A
Cytosine (C):G
Guanine (G):C
Question 4: During which two steps of thermal cycling does base-pairing occur?
Base pairing occurs during extension at 72°C for 30 seconds and the final step at 72°C for 3 minutes. During extension DNA polymerase begins to add the nucleotides after binding to the primer on the DNA strand. During the final step, DNA polymerase finishes adding nucleotides until reaching the end of the strand.
SNP Information & Primer Design
Background: About the Disease SNP
What is a nucleotide?
Compound that has a nucleoside and a phosphate group. (form the basic structural unit of nucleic acids such as DNA)
What is a polymorphism?
A gene is polymorphic if more than one allele occupies that gene’s locus within a population. (Ex: In dogs the E locus controls coat pattern and there are 5 different types of alleles)
What species is this variation found in? (latin name)
Homo sapiens
What chromosome is the variation located on?
Chromosome 4
What is listed as the clinical significance of of this SNP?
Pathogenic (1) / Benign (3) Controversy
What condition is linked to this SNP?
Cardiac arrhythmia, Long QT Syndrome, Cardiovascular Phenotype
What does ANK2 stand for?
Ankyrin 2, neuronal
What is the function of ANK2?
Cell motility, activation, and proliferation
What is an allele?
Alternative form of a gene that occur by mutation but are found at the same place on a chromosome.
The disease-associated allele contains what codon?
C
The numerical position of the SNP is:
113367751
Primer Design and Testing
Non-disease forward primer (20 nt):
5’ GGACAGCTCAGCAACAGCAC
The numerical position exactly 200 bases to the right of the disease SNP is:
113367951
Non-disease reverse primer (20 nt):
5’ CCTGTCGAGTCGTTGTCGTG
Disease forward primer (20 nt):
5’ GGACAGCTCAGCAACAGCAA
Disease reverse primer (20 nt):
5’ CCTGTCGAGTCGTTGTCGTT
Summary: The primer that does not result in having the disease has a nucleotide of C. The nucleotide is located at 113367751. For the disease to be present, the primer will have a nucleotide of A instead of C. This results in the reverse primer having a nucleotide of T instead of G.
BME 100 Fall 2016
