BME100 f2015:Group6 1030amL4

BME 100 Fall 2015	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Caroline Dolt(s) Kamrie Ickes(s) Rex Moore Connor Beck Name: Chricitan B. Adane Andres X. Gandara LAB 4 WRITE-UP Protocol Materials Lab coat and disposable gloves PCR reaction mix, 8 tubes, 50 microliters each: Mix contains Taq DNA Polymerase, MgCL2, and dNTP's(http://www.promega.com/resources/protocols/product-information-sheet/g/gotag/colorless-master-mix-m714-protocol/) DNA/primer mix, 8 tubes, 50 microliters each: Each mix contains a different template DNA. All tubes have the same forward primer and reverse primer. A strip of empty PCR tubes Disposable pipette tips: only use each only once. Neverre-use disposable pipette tips or samples will be cross-contaminated Cup for discarded tips Micropipetter OpenPCR machine: shared by two groups PCR Reaction Sample List Tube Label PCR Reaction Sample Patient ID G6 + Positive control none G6 - Negative control none G6 1-1 Patient 1, replicate 1 41418 G6 1-2 Patient 1, replicate 2 41418 G6 1-3 Patient 1, replicate 3 41418 G6 2-1 Patient 2, replicate 1 39567 G6 2-2 Patient 2, replicate 2 39567 G6 2-3 Patient 2, replicate 3 39567 DNA Sample Set-up Procedure Step One: Extract the DNA from the desired cell and place it in a small specially designed PCR tube Step Two: Identify what fragment sequence to replicate and decide what primers will isolate that sequence, Two primers are required; one to stick to the top strand and one to stick to the bottom strand. Step Three: Add Primer one to the PCR tube with the DNA Step Three: Add Primer two to the PCR tube Step Four: Add nucleotides to the PCR tube Step Five: Add Taq DNA Polymerase last to the PCR tube Step Six: Place the PCR tube into the thermal cycler OpenPCR program Inside the thermal cycler, a process of heating and cooling works to make the DNA replicate at a fast pace. First, the tube is 95 degrees Celsius for 2 minutes. The replication begins at the same temperature for an additional 30 thirty seconds, the DNA unwinds and denatures to allow the primers to attach to each end of the target sequence. The primers attach as the thermal cycler suddenly cools to 57 degrees Celsius for 30 seconds. The primers attract the Taq DNA Polymerase which begins to work as the cycler warms up to 72 degrees Celsius for 30 seconds. This process is repeated 25 times until millions of the DNA fragment are made. Finally, the cycler cools to 72 degrees Celsius for 2 more minutes before cooling all the way to 4 degrees Celsius. Research and Development PCR - The Underlying Technology Function of each PCR reaction component. The template DNA is the first component of the PCR reaction. The DNA is used to replicate the desired strand of DNA to find the disease, or other genetic information, and replicate the DNA many times to make the genetic information more prominent which makes it easier to detect the presence of the disease. The primers are custom made sequences of nucleotides which bind to a specific region of the template DNA. The primers are important because without the primers Taq polymerase would not be able to bind to the DNA. The primers also locate the exact strand to DNA that is to be replicated. The Taq poylmerase is a natural component of the cell which binds to the template DNA strand at the primer. The Taq polymerase takes nucleotides that are within the nucleus and matches the base pairs to the nucleotides that are on the template DNA. The nucleotides are the four molecules Adenine (A), Thymine (T), Cytosine (C), and Guanine (G). A and T are base pairs and C and G are base pairs which means that A binds to T and C only binds to G. All DNA is made up of these four molecules. Effect of PCR reaction on each component When the thermal cycler is heated to a temperature of 95 degrees Celsius, the PCR tube gets extremely hot. The DNA, which was once in the form of a double helix, is separated into two single strands of DNA. The temperature is cooled down to 57 degrees celsius. The single strands of DNA want to attach back to each other, but since there are many more primers in the solution, one primer is attached to each strand of DNA. The temperature is raised to 72 degrees celsius, which activates the DNA polymerase. The polymerase connects to the section of the DNA containing the primer. Starting at the place where it was connected, it assigns nucleotides to their complimentary pairs on the strand. It falls off once it reaches the end of the DNA. At this point, the reaction is completed, and the DNA has been successfully replicated. DNA Base Pairing In DNA, there are four nucleotides used to build genetic information. Adenine, Thymine, Cytosine, and Guanine are all nitrogenous bases that make up the helix in DNA. These nucleotides pair with each other but very specifically. Adenine only pairs with Thymine(and vice versa) and Guanine only pairs with Cytosine(and vice versa) and these are the pairs that anneal together during that phase of PCR. Base Pairing During the Thermal Cycling During thermal cycling, base pairing occurs during the annealing and extending phases. The annealing phase is when the cycler cools to 57 degrees Celsius which is the perfect temperature for the primers to attach. The primers are pieces of DNA that attach at the desired end of the fragment targeted for replication. The other phase during which base pairing occurs is the extending phase where the cycler warms to 72 degrees Celsius. During this phase, the Taq DNA Polymerase attaches and matches up the free floating nucleotides added pre-thermal cycler to the DNA strand starting at a primer. The Polymerase finishes the new strand of DNA before the cycle begins again. SNP Information & Primer Design Background: About the Disease SNP SNP stands for 'single nucleotide polymorphism'. This means that a single nucleotide within the gene has switched out a nucleotide base. A nucleotide is a nitrogenous base that makes up the genetic code and helix of a DNA molecule. In this case with SNP rs1805008, a cytosine switches with thymine in chromosome 16:89919736 of homo sapiens. This forms the gene MC1R that has been linked to melanoma, a type of aggressive skin cancer. MC1R stands for melanocortin 1 receptor that has many functions, including monitoring melanocortin receptor activity, melanocyte-stimulating hormone receptor activity, and protein binding. The disease-associated allele, an allele being 3 base pairs that call for a protein, TGG causes the mutation at base 89,919,736. Primer Design and Testing Non-disease Primers: CAGCATCGTGACCCTGCCGC CTTGTGGAGCCGGGCGATGC There was a match for these primers because they are the normal, non-diseased DNA fragments. Diseased Primers: CAGCATCGTGACCCTGCCGT CTTGTGGAGCCGGGCGATGC There are no matches within the human genome project because there is a mutation within the sequence.