BME100 f2013:W1200 Group18 L6

From OpenWetWare

Jump to: navigation, search
BME 100 Fall 2013 Home
People
Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3
Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png

Contents

OUR COMPANY

Name: Nikhil Patel
Name: Nikhil Patel
Name: Carlyn Harris
Name: Carlyn Harris
Name: Victoria Platt
Name: Victoria Platt
Name: Alexandra Olson
Name: Alexandra Olson
[]
Name: Matthew Armas
Name: Matthew Armas


Company name: Disease Detectors
Product name: PCR Powerhouse 5000


LAB 6 WRITE-UP

Computer-Aided Design

TinkerCAD

TinkerCAD is a website that has a tool where you create objects. When using the tool, your work space is on a flat plain. On that plain you can use different objects and put them together to create a whole new object. Once created you can then print the object to from a 3D printer to create a model of the object. TinkerCAD is an easy to use site and tool to where you can create, share, and print your objects.

ASU colors to make it look awesome. GO ASU!

Implications of Using TinkerCAD for Design

Redesigning a device such as the OpenPCR machine could be extremely beneficial for running DNA sequences in a lab setting. If any part in the OpenPCR machine is broken and needs to be replaced, TinkerCad is able to make a new model of the broken part. From here, the Tinkercad file can then be uploaded to a computer containing a 3D printer-compatible software and a prototype of the part can be printed in an hour or so. After the prototype is tested, if any adjustments need to be made, Tinkercad can be used to correct errors and retest another prototype. In fact, Tinkercad could be used to redesign the entire OpenPCR machine to be lighter and smaller, lowering the cost while maintaining efficiency. Additionally, Tinkercad may be used to increase the number of sample tube slots in the tray, allowing more efficient data analysis. Using TinkerCad is simple after a bit of experience and printing, with the right software and training, is also relatively easy.



Feature 1: Cancer SNP-Specific Primers

Background on the Cancer-Associated Mutation
A nucleotide consists of a nucleotide base, a phosphate group and a five carbon sugar and a polymorphism is one or more variation of a particular DNA. rs17879961 is a single nucleotide polymorphism that is expressed in Homo sapiens. This pathogen is located on the 22nd chromosome and its main function is altering the CHEK2. CHEK2 stands for checkpoint kinase 2 and its main function is to prevent mitosis and tumor growth. CHEK2 is activated when a damaged DNA is detected in order to ensure that the strand will not replicate uncontrollably fast. Therefore, once there becomes a mutation on the gene that promotes CHEK2 production, the growth of tumors and mutated DNA is not so regulated or suppressed.



Primer Design

  • Forward Primer: 5'TGTAAGGACAGGACCAAATTT
  • Cancer-specific Reverse Primer: 5'TGTAAGAGTTTTTAGGAACC

How the primers work: Primers are the starting point for DNA replication and consist of a strand of nucleic acid that is complementary to the DNA strand. One an enzyme attached itself to a DNA primer in transcription, the process of DNA replication begins. The reverse primer binds to the complementary cancer containing template. The primer will only bind to the complementary strand and therefore it will only replicate DNA with the cancer allele.



Feature 2: Consumables Kit

In our kit, the consumables will be packaged in a different way. The disposable tips (for the micropipette), for example, will arrive neatly in a box. There will be a user-friendly instruction manual included. Lastly, the dye will be packaged in a sleeve.

This new packaging method addresses a couple of major weaknesses. Currently, the disposable tips are thrown haphazardly into plastic bag. Even with gloves on, this setup makes it difficult for the consumer to get one or two tips out of the bag without contaminating the others. A box with a slot for each tip makes this process more efficient. On the issue of contamination, a brief instruction manual is necessary in order to educate the consumer on how to best handle the materials. It is a mistake to assume that everybody who orders this kit will be familiar with it. The sleeve for the dye is important as well; it prevents unnecessary light exposure, especially when the box is first opened and the dye is not used immediately. It is a known fact that light destroys its properties. When faulty dye is used, it can affect the results of an experiment. So will any unnecessary contamination of the tips and other included materials.


Feature 3: PCR Machine Hardware

Our new and improved PCR machine will be nearly identical in physical appearance, being already relatively small and compact, we decided to leave the outer design the same. The main aspect that will change is the programming, internal design, and user friendly ability. This new PCR machine will run more efficiently and will produce results much quicker. The internal hardware and electronics will be replaced with newer, more advanced technology that will be easier to use and will make it so hospitals can generate results in a matter of minutes instead of hours.

Feature 4: Fluorimeter Hardware

In our system, all the necessary equipment (the box, camera stand, disposable slides, and fluorimeter) will be included. The box will be able to block out all the external light.

The only redesign to the fluorimeter system is to include a better box that will block out all light. The light from the surroundings can affect the clarity of the pictures and even the affect of the SYBR green dye and thus affecting the results of the experiment. ImageJ is a very sensitive computer program and even the slightest picture error can skew results. The slides, on the other hand, are a strength because they are disposable. In other words, this minimizes the amount of contamination.



Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach

The result for calculation 3 describes the probability that the patient will actually develop cancer given that they have a positive DNA cancer sequence from the CHEK2 P test (P(A|B)). The P(B|A) value which represents the fraction of non-cancer DNA sequences that also are given a "no" to developing cancer was significantly under one as was the P(A|B) value. This signifies that the CHEK2 PCR test is not very reliable according this calculation as the probability a patient has cancer given a cancer DNA sequence is very small because a very large amount of positive PCR conclusions resulted in a non-cancerous biopsy report.

The results for calculation 3 describe the probability that the patient does not have cancer given a non-cancer DNA sequence with the CHEK2 PCR test. The P(B|A) value, representing the fraction of non cancer DNA sequence occuring given a "no" on developing cancer was closer to 1 than it's respective value in calculation 3 but still not convincing enough. It would be most convincing if this number was much closer to one. In turn, the P(A|B) value was closer to 1 than it's respective value in calculation 3. This calculation demonstrates the PCR test as slightly more reliable as the probability that the patient will not have cancer given a non cancer sequence is closer to one. However, many negative PCR conclusions still resulted in a cancerous biopsy. Even the slightest chance that a patient with cancer could be diagnosed without it using this test is not something that should be relied upon.

Therefore, it seems that the CHEK2 PCR test performed in lab was more reliable when detecting a non cancer DNA sequence than a cancer DNA sequence but still not convincing.

Personal tools