840:153g:Projects/project23

Team Members

• Valerie Wisco
• Casey Durnan

Cloning of the Outer Membrane f-type Cytochrome(OmcF) gene

• Background Information

One of the best and most studied organisms on the production of bioelectricity would be the anaerobic bacteria of Geobacter sulfurreducens.This microbe is able to produce high current densities in microbial fuel cells and there has been broad studies on extracellular electron transfer to Fe(III) oxide in this organism which might provide insights into extracellular electron transfer to electrodes. Through some research Geobacter sulfurreducens has been shown to have several outer membrane cytochromes that may be involved in the electricity production. One particular gene, the outer membrane f-type cytochrome or OmcF gene has shown its involvement in the electricity production process through a study done by researchers at the University of Massachusetts. In this study they worked with OmcF deficient microbes and found that there was a significant decrease in the reduction of Fe(III) and a decrease in current production in this microbe. By the tests done by the researches, OmcF is is shown to be required for proper levels of transcription of other genes that are highly regulated when this microbe grows on the surface of an anode of a microbial fuel cell as compared to the growth on a soluble electron acceptor. Thus showing that the OmcF plays a role in regulating proteins that help aid in the electron transport across the cell membrane. This involvement is why we have chosen to clone this particular gene.

• OmcF Gene Information:
  

Accession Number:AAR35805.1
315 base pairs;no introns
The culture was received from researchers at the University of Massachusetts, compliments of Joy Ward, Lab Manager
It will be cultured in NBAF media and grown until appropriate extraction takes place.

• General Procedure:

1.)Grow Geobacter sulfurreducens on NBAF media
2.)DNA extraction
3.)PCR amplification
4.)Quality check/ purify DNA by electophoresis
5.)Digestion of source DNA and promoter
6.)Ligation
7.)Digestion/Ligation of new part and plasmid
8.)Transformation into E. Coli host
9.)Antibiotic selection- Kanomycin resistent vector
10.)Verify through SDS-PAGE

• Primer Selection
  

23F_omcfsf - 5’= GAATTCGCGGCCGCTTCTAGAGATGAGAGGGCTTGCCCCGGT=3’
23R_omcfsr - 5’= TACTAGTAGCGGCCGCTGCAGTCATGGGAAGCTCGCCACGA=3'
23F_omcfmf - 5’= GGCCCTGGCGGCCGGTTGCAGCGGCGGGTCCGGCGC=3’
23R_omcfmr - 5’= GCGCCGGACCCGCCGCTGCAACCGGCCGCCAGGGCC=3’

• Promoter Selection
  

pBad/araC which is induced through the use of L-arabinose, and inhibited by araC [1]

• Vector Selection:
  

psB2k3 [2]

• Powerpoint Presentation:
  

Image:Cloning the omcF gene-1.ppt

• Final Presentation::
  

Image:Recombinant DNA- Final Presentation 2b.pptx

References

Kim, B., Postier, B., DiDonato, R., Chaudhuri, S., Nevin, K., & Lovely D. (2008). Insights into genes involved in electricity generation in geobacter sulfurreducens via whole genome microarray analysis of the omcf-de!cient mutant. Bioelectrochemistry, Retrieved from http://www.geobacter.org/publication-files/18538641.pdf [3]

http://www.ncbi.nlm.nih.gov/nuccore/NC_002939.5?report=genbank&from=2667181&to=2667495&strand=true----

http://www.geobacter.org/about

• Please also make yourself familiar with uploading pictures and *.ppt files

Important Results and Milestones

• keep track of your most important results and refer to the corresponding page in your notebook
• upload important pictures (don't forget to label them! Powerpoint is very convenient). Remember: these will become quite handy later in your summary report or final presentation. If you do label and upload the pictures as soon as you got them, your summary report can be written much more effortlessly (do you usually procrastinate? This is chance to do some work before hand that frees you up for finals week).

Recent changes