840:153g:Projects/project19

Team Members

• Orijit Kar
• Beth Anderson
• Cassidy Albertson

Cloning Cstps1 Gene from 'Citrus sinensis'

We will be cloning the Cstps1 Gene from Citrus Sinensis. This gene is responsible for producing an enzyme which reacts with FPP (farnesyl pyrophosphate)to produce valencene, the major component of the citrus scent of oranges. The gene was located on the Genbank of the NCBI website with the accession number AF441124.1. The gene contains 1647 bp without introns. We will design 2 different sets of primers. One set will be compatible with the biobrick ends and the other set will not. The primers are listed below. After the gene is cloned, it will be transformed into competent E. coli. The transformational goal is to have the bacteria express the gene that will produce the enzymatic protein citrus valencene synthase."' 'We will then add FPP to the culture. The primary test for a successful cloning operation is through olfaction. If we are able to detect the "orangeish" aroma, our research will have been successful. We may also develop another way to test for the presence of valencene should the olfaction test be inconclusive.

Primers:

19_orange1_F: atgtcgtctggagaaacatt

19_orange2_R: tcaaaatggaacgtggtctc

19_orange1a_F: gaattcgcggccgcttctagatgtcgtctggagaaacatt

19_orange2a_R: tactagtagcggccgctgcagtcaaaatggaacgtggtctc

Project proposal:

 http://openwetware.org/wiki/Image:Project_Proposal.docx

Proposal powerpoint:

 http://openwetware.org/wiki/Image:Cloning_the_Cstps-1_gene_from_Citrus_sinensis_%281%29.pptx

Reference from the Primary Literature:

 • http://onlinelibrary.wiley.com/doi/10.1046/j.1365-313X.2003.01910.x/abstract;jsessionid=BD9BB33B719AB56A13E5533626AE700B.d02t01

Other important references:

More about our protein product (Valencene synthase)

 * http://www.sciencedirect.com/science/article/pii/S1360138504000573
 

DNA extraction technique -

 * http://www.springerlink.com/content/t21qv4872272557v/

FINAL http://openwetware.org/index.php?title=Image:Recomrecov2.pptx&oldid=571493

Important Results and Milestones

After two unsuccessful attempts to extract DNA from fruit and peel tissue, we were able to do so using leaf tissue. Giggity.

Recent changes