840:153g:Projects/project14
From OpenWetWare
Customize your entry pages
| |
Team MembersMegan Hughes, Kim Lovik
"Cloning of the Orcinol O-methyltransferase 2 (OOMT2) Gene in Roses."The OOMT2 gene was chosen to attempt to clone the "scent" from the rose. The exact gene sequence has been located using the NCBI gene bank, accession AJ876303.1, and contains 1321 bp and one intron. DNA will be extracted from the petals of a common rose species. Using flanking primers that have been designed specifically for this gene sequence, the gene will be amplified using PCR. Two sets of primers will be designed, one containing extended BioBrick-compatible ends and another, free of the BioBrick ends. Amplification of the gene will first be attempted using the primers not containing the extensions. TA Cloning will be used to introduce our gene into the T-Vector. Once complete, the gene will be amplified using competent E.Coli and sequencing will be done to ensure the vector contains the OOMT2 gene. After sequencing, one internal restriction site will be removed by using site-directed mutagenesis. Two additional overlapping primers will be designed for this step. Once the internal restriction site has been removed, XbaI restriction enzyme will be introduced to the DNA and agarose gel electrophoresis will be performed to check for proper gene length. The gene will then be removed from the T-Vector using specific BioBrick compatible enzymes, and then placed into the BioBrick vector containing a specific promoter (3 options listed below) which will express the gene in the presence of L-Arabinose. The plasmid vector containing the spliced gene fragment will then be transformed into chemically competent E.Coli bacteria and allowed to grow. After growth, the plasmid DNA will be isolated and sequenced to test if the gene fragment is present. An additional chemical compound will be used to test for the function of the cloned OOMT2 gene. OOMT2 is used to methylate 3-methoxy-5-hydroxytolune (MHT), creating 3,5-dimethoxytoluene, which is the major scent compound of many modern rose varieties. If scent is detected after adding MHT to our culture, it can be suggested that the OOMT2 gene was successfully cloned. Research Article Source: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2311369/?tool=pubmed doi: 10.1073/pnas.0711551105 Power Point Presentation: http://openwetware.org/wiki/Image:CloningOOMT2.ppt
14ExonA2_R: tgcaatatcccttgagtaaaactgtatc 14ExonB1_F: aaatgagttcggatattgcatgactgg 14ExonB2_R: tcaaggataaacctcaat 14BB_F: gaattcgcggccgcttctagatggaaaggctaaacagc 14BB_R: tactagtagcggccgctgcagtcaaggataaacctcaat 14RS_F: acttaagcgagctagagaagc 14RS_R: gccactctagctcgcttaagt Promoters BBa_K206000 (induced with the presence of L-Arabinose) BBa_K094120 (induced with the presence of IPTG or Arabinose) BBa_K206001 (induced with the presence of L-Arabinose) Photos: The following photos represent gel electrophoresis procedures performed at different points in our experiement. Photo 1: DNA extraction: The gel shows the outcome of our first attempt at isolating DNA from our Rose. We attemped to extract DNA from both the petals and the leaves. The DNA samples were digested with Xbal enzyme to check for purification as well. http://openwetware.org/wiki/Image:%2192211DN.A.tif Photo 2: PCR Product: The following picture shows the rsults of an initial PCR reaction that was done using our leaf DNA that had been extracted. This was done using non-biobrick primers, at varying annealing temperatures. We were looking for two different banding sizes, one at arpx. 300bp, and one at aprx. 800bp. Good banding was seen for the 300bp but none for the 800bp segement. http://openwetware.org/wiki/Image:9-29-22.tif#file Photo 3: PCR Product #2: A second PCR reaction was attemped on the same DNA sample with different annealing temperatures to attempt to attain banding at 800bp, indicating both our 300bp gene fragment and our 800bp gene fragment had been successfully amplified. The results yielded both fragments. http://openwetware.org/wiki/Image:10-6-11.tif Photo 4: PCR Product #3: This PCR reaction was done in attempt to rejoin our two gene fragments into our 1100bp OOMT2 gene. This reaction was not successful for the annealing temperatures used, indicated by multiple bands in each lane instead of one band at 1100bp. http://openwetware.org/wiki/Image:10-13-11.tiff Photos 5 & 6: PCR Products #4: The following two pictures represent a multitude of PCR reactions that were set up to attempt to reattach our two gene fragments. We included our BioBrick primers in this reaction to see if we could get some results using those and the non-biobrick primers. We had some positive results where we were able to cut certain bands at 1100 bp to be used in further experimentation. http://openwetware.org/wiki/Image:10-18-113.tif http://openwetware.org/wiki/Image:10-18-11_%282%29.tif Photo 7: Bands were cut from the previous gels and the following picuture is representing the extracts taken from the gels. There were two different sizes of bands seen on this gel, and since they were so close in size, we decided to use all of the samples for plasmid T-Vector ligation. http://openwetware.org/wiki/Image:10-20-11.tif Photo 8: After attempting to ligate our gene into a T-Vector plasmid, we transformed competent E.Coli with the plasmids, harvested colonies, isolated plasmids, and ran a restriction digest to see if infact the plasmids had taken up our gene and that the gene had been succesfully amplified. We expected to see bands at 3000bp (the plasmid), and 1100 bp (our gene). The was not seen in the gel. http://openwetware.org/wiki/Image:%2111311.tif Photo 9: The following is a photo of our final restriction digest done on our isolated plasmids. The photo shows all lanes containing single bands aprox. 3000bp, which would indicate that the samples contained plasmid only. The single bands could also indicate that the Restriction Enzyme (EcoRI) was not working properly, unable to remove any inserted products. http://openwetware.org/wiki/Image:%21112911.tiff
Important Results and Milestones |
|



