User talk:Hossein Azari Soufiani: Difference between revisions
Line 235: | Line 235: | ||
== Project == | == Project == | ||
I want to try and understand the information structure in different evolutionary dynamics. | |||
By Information structure I mean looking at entire path of evolution and trying to understand a unique structure for that. | By Information structure I mean looking at entire path of evolution and trying to understand a unique structure for that. |
Revision as of 13:27, 29 September 2009
Report of Second Homework
The paper "Foundations for the Engineering Biology" was really interesting for me because I am an engineer and I like to see the problems from engineering point of view. The paper was written in a very classic engineering manner and it made understanding of our position in Bioengineering more clear for me.
Installing and preparing Python was very different than the other programs which I used before like Matlab, C++. I enjoyed using it, specially the object oriented programing ability makes it really powerful. Plot for Python is very similar to Matlab and we have same commands with a little bit difference. Here you see a plot for three different growth rates for exponential function plotted with different colors.
Code for Third Homework
import random import numpy as np
print print
Code='cggagcagctcactattcacccgatgagaggggaggagagagagagaaaatgtcctttaggccggttcctcttacttggcagagggaggc tgctattctccgcctgcatttctttttctggattacttagttatggcctttgcaaaggcaggggtatttgttttgatgcaaacctcaatccctccc cttctttgaatggtgtgccccaccccccgggtcgcctgcaacctaggcggacgctaccatggcgtagacagggagggaaagaagtgtgcagaaggc aagcccggaggcactttcaagaatgagcatatctcatcttcccggagaaaaaaaaaaaagaatggtacgtctgagaatgaaattttgaaagagtgc aatgatgggtcgtttgataatttgtcgggaaaaacaatctacctgttatctagctttgggctaggccattccagttccagacgcaggctgaacgtc gtgaagcggaaggggcgggcccgcaggcgtccgtgtggtcctccgtgcagccctcggcccgagccggttcttcctggtaggaggcggaactcgaat tcatttctcccgctgccccatctcttagctcgcggttgtttcattccgcagtttcttcccatgcacctgccgcgtaccggccactttgtgccgtac ttacgtcatctttttcctaaatcgaggtggcatttacacacagcgccagtgcacacagcaagtgcacaggaagatgagttttggcccctaaccgct ccgtgatgcctaccaagtcacagacccttttcatcgtcccagaaacgtttcatcacgtctcttcccagtcgattcccgaccccacctttattttga tctccataaccattttgcctgttggagaacttcatatagaatggaatcaggatgggcgctgtggctcacgcctgcactttggctcacgcctgcact ttgggaggccgaggcgggcggattacttgaggataggagttccagaccagcgtggccaacgtggtg' RCCode=Code TempCode=Code
print 'Code=',Code print print
pro1=range(1,339)
pro2=range(1,339)
pro3=range(1,339)
prom1=range(1,339)
prom2=range(1,339)
prom3=range(1,339)
- ----------------------Problem one --------------------------------------------
GCcontent=0
for i in range(0,len(Code)-1):
if Code[i]=='c': GCcontent=GCcontent+1 elif Code[i]=='g': GCcontent=GCcontent+1
print 'GC Content=',GCcontent
print
print
print
print
- ----------------------Problem two---------------------------------------------
for i in range(0,len(Code)-1):
if Code[len(Code)-1-i]=='c': RCCode=RCCode[:i]+'g'+RCCode[i+1:] if Code[len(Code)-1-i]=='g': RCCode=RCCode[:i]+'c'+RCCode[i+1:] if Code[len(Code)-1-i]=='t': RCCode=RCCode[:i]+'a'+RCCode[i+1:] if Code[len(Code)-1-i]=='a': RCCode=RCCode[:i]+'t'+RCCode[i+1:]
print 'Recerse Complement=:', RCCode print print
- ----------------------Problem Three---------------------------------------------
Here we put the table That I didn't put because it doesn't look good!!!
for i in range(0,338):
Temp1=Code[3*i]+Code[3*i+1]+Code[3*i+2] Temp2=Code[3*i+1]+Code[3*i+2]+Code[3*i+3] Temp3=Code[3*i+2]+Code[3*i+3]+Code[3*i+4]
pro1[i]=standard[Temp1] pro2[i]=standard[Temp2] pro3[i]=standard[Temp3]
Temp1=RCCode[3*i]+RCCode[3*i+1]+RCCode[3*i+2] Temp2=RCCode[3*i+1]+RCCode[3*i+2]+RCCode[3*i+3] Temp3=RCCode[3*i+2]+RCCode[3*i+3]+RCCode[3*i+4]
prom1[i]=standard[Temp1] prom2[i]=standard[Temp2] prom3[i]=standard[Temp3]
print 'Sequence of (+1) frame' print pro1
print 'Sequence of (+2) frame' print pro2
print 'Sequence of (+3) frame' print pro3
print 'Sequence of (-1) frame' print prom1
print 'Sequence of (-2) frame' print prom2
print 'Sequence of (-3) frame' print prom3
- -----------------------------Problem Four---------------------------
counter=0 for j in range(0,1000):
Code=TempCode for i in range(0,10):
Te=random.random() Te=np.fix(100*Te) Te2=random.random() Te2=int(np.fix(10*Te2))%3
if (Code[100*i+int(Te)]=='c') and (Te2==1): Code=Code[:100*i+int(Te)]+'g'+Code[100*i+int(Te)+1:] elif (Code[100*i+int(Te)]=='c') and (Te2==2): Code=Code[:100*i+int(Te)]+'t'+Code[100*i+int(Te)+1:]
elif (Code[100*i+int(Te)]=='c') and (Te2==0): Code=Code[:100*i+int(Te)]+'a'+Code[100*i+int(Te)+1:]
elif (Code[100*i+int(Te)]=='t') and (Te2==1): Code=Code[:100*i+int(Te)]+'g'+Code[100*i+int(Te)+1:] elif (Code[100*i+int(Te)]=='t') and (Te2==2): Code=Code[:100*i+int(Te)]+'c'+Code[100*i+int(Te)+1:]
elif (Code[100*i+int(Te)]=='t') and (Te2==0): Code=Code[:100*i+int(Te)]+'a'+Code[100*i+int(Te)+1:]
elif (Code[100*i+int(Te)]=='g') and (Te2==1): Code=Code[:100*i+int(Te)]+'c'+Code[100*i+int(Te)+1:] elif (Code[100*i+int(Te)]=='g') and (Te2==2): Code=Code[:100*i+int(Te)]+'t'+Code[100*i+int(Te)+1:]
elif (Code[100*i+int(Te)]=='g') and (Te2==0): Code=Code[:100*i+int(Te)]+'a'+Code[100*i+int(Te)+1:]
elif (Code[100*i+int(Te)]=='a') and (Te2==1): Code=Code[:100*i+int(Te)]+'g'+Code[100*i+int(Te)+1:] elif (Code[100*i+int(Te)]=='a') and (Te2==2): Code=Code[:100*i+int(Te)]+'t'+Code[100*i+int(Te)+1:]
elif (Code[100*i+int(Te)]=='a') and (Te2==0): Code=Code[:100*i+int(Te)]+'c'+Code[100*i+int(Te)+1:]
pro21=range(1,339) pro22=range(1,339) pro23=range(1,339)
for i in range(0,338):
Temp1=Code[3*i]+Code[3*i+1]+Code[3*i+2] Temp2=Code[3*i+1]+Code[3*i+2]+Code[3*i+3] Temp3=Code[3*i+2]+Code[3*i+3]+Code[3*i+4]
pro21[i]=standard[Temp1] pro22[i]=standard[Temp2] pro23[i]=standard[Temp3]
for i in range(0,len(pro21)-1):
if pro21[i]=='*' and pro1[i]!='*': counter=counter+1
print 'Percent of Premature Termination=',counter,'/1000' print print
print 'Before Mutation:', pro1 print print
print 'After Mutation:', pro21
input()
Project
I want to try and understand the information structure in different evolutionary dynamics.
By Information structure I mean looking at entire path of evolution and trying to understand a unique structure for that.
We already have a big lab of evolutionary dynamics in the nature and human society. For example considering a replication and selection structure for language evolution will give us a good sense of how replication and mutation iteratively make selection to vary. We can call teaching or spreading a word among people replication and selection will happen if a word is useful and easy to use. This path will lead us to build structures which we call it grammar and then grammar will act as a new selection for new objects which we want to generate. Mutation is the change in the words or making new words.
Generalizing evolutionary idea in this way helps us to develop a measurement to understand this big sample we have so far and think about future of that. There will be big parallels among different paths like evolution of language , evolution of science and etc. Also we will see some differences like the rate of evolution which will give us some intrinsic property of this path for different cases.
I will write more...