User:Torsten Waldminghaus/Notebook/Methylation array

Idea

• Analyse the methylation of GATC sites genomewide in E. coli.

Notes

• Løbner-Olesen et al, 2003 [1] used a aroK17::cat strain to have more hemimethylation in the cell, since a polar effect on dam leads to a reduced Dam content in the cell (only 30% of wt [2]). Could be used as control and for interesting analysis.
• methylation in different strains could be interesting:
  • dam-overproduction
  • seqA deletion, over-production, under-production
  • synchronized cells
  • does introduction of a GATC cluster alter methylation of surrounding sites?
• what about GATC sites in datA? sequestration?
• one could compare methylation in protein coding regions with intergenic regions and RNA coding.
• one could analyse effect of distance to oriC and density of GATCs

• REN to cut the chrom. DNA in the first step could be MseI which was used before [3]. It cuts TTAA and can be heat inactivated at 65 °C for 20 min (http://www.neb.com/nebecomm/products/productR0525.asp).

• As independent method and first step one could analyse cutting by methylation sensitive REN with qPCR
  • on whole chromosome
  • clusters and isolated GATCs
  • coding regions and intergenic regions

Possible restriction enzymes that are Dam methylation sensitive:

Enzyme	Site	Notes	Link
HphI	GGTGA	No star activity; reaction at 37°C; heatinactivation at 20 min 65°C	http://www.fermentas.com/catalog/re/hphi.htm
MboII	GAAGA	Star activity; reaction at 37°C; heatinactivation at 20 min 65°C	http://www.fermentas.com/catalog/re/mboii.htm
TaqI	TCGA	No star activity; reaction at 65 °C; no heatinactivation after 20 min 80°C	http://www.fermentas.com/catalog/re/taqi.htm

• HphI seems to be a goog choice since it can be heatinactivated and has no star activity (does not cleave unspecific when DNA is overdigested).
• In unsynchronized cultures the detection of hemimethylation will be difficult. If every GATC is hemimethylated for about 1 min and replication of the chromosome takes about 50 min, than about 2% of a specific GATC will be in a hemimethylated state giving only 1% cut with an overlapping enzyme.
  • One possibility to make the restriction outcome higher could be to use sites like ggtgatcacc that have two HphI restriction sites overlapping one GATC. This should give a doubling in cutting at that site compared to only one HphI site. However, a 10bp long inverted repeat might not give a representative result for GATC methylation because some whatever protein could bind there. The E. coli K12 genome contains 33 ggtgatcacc sites:

Start     End Pattern_name Mismatch Sequence
118460  118469 pattern1            . GGTGATCACC
143911  143920 pattern1            . GGTGATCACC
210581  210590 pattern1            . GGTGATCACC
282472  282481 pattern1            . GGTGATCACC
330621  330630 pattern1            . GGTGATCACC
379605  379614 pattern1            . GGTGATCACC
405197  405206 pattern1            . GGTGATCACC
599247  599256 pattern1            . GGTGATCACC
636380  636389 pattern1            . GGTGATCACC
681039  681048 pattern1            . GGTGATCACC
685084  685093 pattern1            . GGTGATCACC
712647  712656 pattern1            . GGTGATCACC
826095  826104 pattern1            . GGTGATCACC
834158  834167 pattern1            . GGTGATCACC
854836  854845 pattern1            . GGTGATCACC
900826  900835 pattern1            . GGTGATCACC
1065260 1065269 pattern1            . GGTGATCACC
1107328 1107337 pattern1            . GGTGATCACC
1363023 1363032 pattern1            . GGTGATCACC
2152717 2152726 pattern1            . GGTGATCACC
2358426 2358435 pattern1            . GGTGATCACC
2540379 2540388 pattern1            . GGTGATCACC
2953039 2953048 pattern1            . GGTGATCACC
3010031 3010040 pattern1            . GGTGATCACC
3042067 3042076 pattern1            . GGTGATCACC
3268923 3268932 pattern1            . GGTGATCACC
3528134 3528143 pattern1            . GGTGATCACC
3540084 3540093 pattern1            . GGTGATCACC
3607305 3607314 pattern1            . GGTGATCACC
3858080 3858089 pattern1            . GGTGATCACC
4238710 4238719 pattern1            . GGTGATCACC
4292770 4292779 pattern1            . GGTGATCACC
4463247 4463256 pattern1            . GGTGATCACC

• found with http://mobyle.pasteur.fr/cgi-bin/MobylePortal/portal.py?form=fuzznuc

Name (localisation of HphI site)	MseI sites	GATCs	Sequence	Size of MseI fragment	Oligos for qPCR
761873						49175990:761139-761970 Escherichia coli str. K-12 substr. MG1655, complete genome TTAAAGGCACCGGTGTGGGTGGTCGTCTGACTCGTGAAGATGTGGAAAAACATCTGGCGAAAGCCCCGGC GAAAGAGTCTGCTCCGGCAGCGGCTGCTCCGGCGGCGCAACCGGCTCTGGCTGCACGTAGTGAAAAACGT GTCCCGATGACTCGCCTGCGTAAGCGTGTGGCAGAGCGTCTGCTGGAAGCGAAAAACTCCACCGCCATGC TGACCACGTTCAACGAAGTCAACATGAAGCCGATTATGGATCTGCGTAAGCAGTACGGTGAAGCGTTTGA AAAACGCCACGGCATCCGTCTGGGCTTTATGTCCTTCTACGTGAAAGCGGTGGTTGAAGCCCTGAAACGT TACCCGGAAGTGAACGCTTCTATCGACGGCGATGACGTGGTTTACCACAACTATTTCGACGTCAGCATGG CGGTTTCTACGCCGCGCGGCCTGGTGACGCCGGTTCTGCGTGATGTCGATACCCTCGGCATGGCAGACAT CGAGAAGAAAATCAAAGAGCTGGCAGTCAAAGGCCGTGACGGCAAGCTGACCGTTGAAGATCTGACCGGT GGTAACTTCACCATCACCAACGGTGGTGTGTTCGGTTCCCTGATGTCTACGCCGATCATCAACCCGCCGC AGAGCGCAATTCTGGGTATGCACGCTATCAAAGATCGTCCGATGGCGGTGAATGGTCAGGTTGAGATCCT GCCGATGATGTACCTGGCGCTGTCCTACGATCACCGTCTGATCGATGGTCGCGAATCCGTGGGCTTCCTG GTAACGATCAAAGAGTTGCTGGAAGATCCGACGCGTCTGCTGCTGGACGTGTAGTAGTTTAA ||
MboII	GAAGA	Star activity; reaction at 37°C; heatinactivation at 20 min 65°C	http://www.fermentas.com/catalog/re/mboii.htm
TaqI	TCGA	No star activity; reaction at 65 °C; no heatinactivation after 20 min 80°C	http://www.fermentas.com/catalog/re/taqi.htm

1. Løbner-Olesen A, Marinus MG, and Hansen FG. Role of SeqA and Dam in Escherichia coli gene expression: a global/microarray analysis. Proc Natl Acad Sci U S A. 2003 Apr 15;100(8):4672-7. DOI:10.1073/pnas.0538053100 |
2. Løbner-Olesen A, Boye E, and Marinus MG. Expression of the Escherichia coli dam gene. Mol Microbiol. 1992 Jul;6(13):1841-51. DOI:10.1111/j.1365-2958.1992.tb01356.x |
3. Pfister S, Schlaeger C, Mendrzyk F, Wittmann A, Benner A, Kulozik A, Scheurlen W, Radlwimmer B, and Lichter P. Array-based profiling of reference-independent methylation status (aPRIMES) identifies frequent promoter methylation and consecutive downregulation of ZIC2 in pediatric medulloblastoma. Nucleic Acids Res. 2007;35(7):e51. DOI:10.1093/nar/gkm094 |
4. Braun RE and Wright A. DNA methylation differentially enhances the expression of one of the two E. coli dnaA promoters in vivo and in vitro. Mol Gen Genet. 1986 Feb;202(2):246-50. DOI:10.1007/BF00331644 |
5. Kücherer C, Lother H, Kölling R, Schauzu MA, and Messer W. Regulation of transcription of the chromosomal dnaA gene of Escherichia coli. Mol Gen Genet. 1986 Oct;205(1):115-21. DOI:10.1007/BF02428040 |
6. Campbell JL and Kleckner N. E. coli oriC and the dnaA gene promoter are sequestered from dam methyltransferase following the passage of the chromosomal replication fork. Cell. 1990 Sep 7;62(5):967-79. DOI:10.1016/0092-8674(90)90271-f |