User:Tk/Notebook/MF/2008/08/12: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
Line 47: | Line 47: | ||
** ACTTTAACTTCTTCA 3.3x 779065-115 | ** ACTTTAACTTCTTCA 3.3x 779065-115 | ||
** entire region from 778734-779115 is full of 15/30 bp repeats | ** entire region from 778734-779115 is full of 15/30 bp repeats | ||
* 24 bp repeat | |||
** CGACCTGAATCTCTTCTATCTTCA 3.1x 617242-315 | |||
* Long repeats | * Long repeats |
Revision as of 17:38, 12 August 2008
Mesoplasma florum simplification | <html><img src="/images/9/94/Report.png" border="0" /></html> Main Page <html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html> </html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html> |
Tandem repeats
|