User:Tk/Notebook/MF/2008/08/12: Difference between revisions

From OpenWetWare
< User:Tk‎ | Notebook‎ | MF‎ | 2008‎ | 08
Jump to navigationJump to search
Line 47: Line 47:
** ACTTTAACTTCTTCA 3.3x 779065-115
** ACTTTAACTTCTTCA 3.3x 779065-115
** entire region from 778734-779115 is full of 15/30 bp repeats
** entire region from 778734-779115 is full of 15/30 bp repeats
* 24 bp repeat
** CGACCTGAATCTCTTCTATCTTCA 3.1x 617242-315


* Long repeats
* Long repeats

Revision as of 17:38, 12 August 2008

Mesoplasma florum simplification <html><img src="/images/9/94/Report.png" border="0" /></html> Main Page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Tandem repeats

  • Poly T and Poly A tracts upstream of switchable genes
    • 044577-92 poly T, upstream of mfl033 ->
    • 284203-18 poly T, upstream of mfl 255/256 ->
    • 437602-18 poly A, upstream of mfl377 <-
    • 523044-59 poly A, upstream of mfl44 <-
    • 529275-90 poly A, middle of unclear gap
    • 533892-907 poly A, upstream of mfl451, slpA
    • 548682-97 poly A, upstream of mfl462, natA
  • Three bp repeats
    • 528051-82 poly TAT, middle of gene
  • Five bp repeats
    • AAATG 3.2x 335951-66
    • ATTTA 3x 507534-48
    • ATTTG 4.2x 548628-47
    • ATTTG 3x 640417-31
  • Six bp repeats
    • AAAGCA 3.3x 091095-114
    • AAAGCA 3.3x 092536-55
    • ATACGA 5.3x 292617-48
    • ATACCA 3.2x 483387-405
  • 7 bp repeats
    • CTTTTTT 3x 141321-141342
  • 9 bp repeat
    • CTTTTTTTG 2.8x 537640-64
    • TAGAAATAC 2.9x 577824-49
  • 15 bp repeats
    • ATAATTGCTCCTAAG 2.3x 404997-405030
    • ACTTTAGCTTCTTCA 2.3x 778871-905
    • TTTTTTAGCTACCGG 2.6x 778963-9001
    • TTTTTTAGCTACCGG 2.6x 779023-61
    • ACTTTAACTTCTTCA 3.3x 779065-115
    • entire region from 778734-779115 is full of 15/30 bp repeats
  • 24 bp repeat
    • CGACCTGAATCTCTTCTATCTTCA 3.1x 617242-315
  • Long repeats
    • 216 bp repeat (3.4x) 403220-403954
    • 333 bp repeat (1.9x) 411116-744
    • 261 bp repeat (10x) in LppQ gene, 518593-521201