User:Tk/Notebook/MF/2008/07/31: Difference between revisions

From OpenWetWare
< User:Tk‎ | Notebook‎ | MF‎ | 2008‎ | 07
Jump to navigationJump to search
Line 22: Line 22:
** Frame 2: 524170-524260
** Frame 2: 524170-524260
** Frame 3: 524275-524485
** Frame 3: 524275-524485
* There may be a six bp repeat outside of the IRL/IRR boundary:
** taagca on the left
** gatgca on the right




Revision as of 13:38, 31 July 2008

Mesoplasma florum simplification <html><img src="/images/9/94/Report.png" border="0" /></html> Main Page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Transposon insertion event at 523000-525000

A pseudogene and inactive IS3/IS1138 transposon is at 523336-524543

  • IRL: 523336-523356
  • IRR: 524523-524543
  • The sequence of the transposon insertion site is: ataaactgggaaaaataaaat


  • Transposase gene has three frame shifts and multiple stop codons (both TAA and TAG)
  • Approximate locations:
    • 523660-524485
    • Frame 1: 523660-523993
    • Frame 3: 523969-524161
    • Frame 2: 524170-524260
    • Frame 3: 524275-524485


  • There may be a six bp repeat outside of the IRL/IRR boundary:
    • taagca on the left
    • gatgca on the right



Retrieved from "https://openwetware.org/mediawiki/index.php?title=User:Tk/Notebook/MF/2008/07/31&oldid=226653"