User:Tk/Notebook/MF-xfm/2008/04/08: Difference between revisions

From OpenWetWare
< User:Tk‎ | Notebook‎ | MF-xfm‎ | 2008‎ | 04
Jump to navigationJump to search
(Autocreate 2008/04/08 Entry for User:Tk/Notebook/MF-xfm)
 
Line 5: Line 5:
|-
|-
| colspan="2"|
| colspan="2"|
==Entry title==
==Primers for recT gene==
* Insert content here...
* gtttcttcgaattcgcggccgcttctagatgaataataaaattgaattaatattaaataattc,recT-F
* gtttcttctactagtagcggccgctgcagttattaatcagaaaacatttcattaacagc,recT-R
* gaaatgcaagaagcctatcaacatgaccaagcaataattattaataacagc,recT-mut-F
* gctgttattaataattattgcttggtcatgttgataggcttcttgcatttc,recT-mut-R
 
 
==Vector NTI file for recT mutated gene==
* from S. citri protein CAK99381
* mutated to eliminate GATC site
* biobricked, entered as part J70007 [[http://parts.mit.edu/registry/index.php/Part:BBa_J70007]]
* [[media:recT-SC.gb]]
 
==Transformations==
* transform E. coli at 2.0 KV outgrow in 1 ml SOC rotated
** plate out 100 &mu;l at 1 hour/2.5 hour/3.5 hour
* transform M. florum frozen cells
** T1, perhaps sparked at 2.0 KV; outgrew anyway
** T2, transformed at 2.0 KV without sparking
** plated out 290 &mu;l at 1 hour and 2 hour and 3 hour
** Added 1 ul Tet to 300 ul culture at 2 hours for T1 and 1 hour for T2
** Plated out both tet and non-tet added cultures for T1 and T2
 
 
==Made electrocompetent cells==
* 5 ml and 500 ul seed culture tubes (50 ml final) grown 18 hours at 30C
* Spin down, resuspend in 45 ml EPB
* again
* again, in 20 ml
* spin down, resuspend in remaining liquid, bring to 250 ul
* add 35 ul 80% glycerol
* Aliquot to 50 ul tubes
* flash freeze in EtOH + dry ice




<!-- ## Do not edit below this line unless you know what you are doing. ## -->
<!-- ## Do not edit below this line unless you know what you are doing. ## -->
|}
|}

Revision as of 21:44, 19 June 2008

MF-xfm <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Primers for recT gene

  • gtttcttcgaattcgcggccgcttctagatgaataataaaattgaattaatattaaataattc,recT-F
  • gtttcttctactagtagcggccgctgcagttattaatcagaaaacatttcattaacagc,recT-R
  • gaaatgcaagaagcctatcaacatgaccaagcaataattattaataacagc,recT-mut-F
  • gctgttattaataattattgcttggtcatgttgataggcttcttgcatttc,recT-mut-R


Vector NTI file for recT mutated gene

  • from S. citri protein CAK99381
  • mutated to eliminate GATC site
  • biobricked, entered as part J70007 [[1]]
  • media:recT-SC.gb

Transformations

  • transform E. coli at 2.0 KV outgrow in 1 ml SOC rotated
    • plate out 100 μl at 1 hour/2.5 hour/3.5 hour
  • transform M. florum frozen cells
    • T1, perhaps sparked at 2.0 KV; outgrew anyway
    • T2, transformed at 2.0 KV without sparking
    • plated out 290 μl at 1 hour and 2 hour and 3 hour
    • Added 1 ul Tet to 300 ul culture at 2 hours for T1 and 1 hour for T2
    • Plated out both tet and non-tet added cultures for T1 and T2


Made electrocompetent cells

  • 5 ml and 500 ul seed culture tubes (50 ml final) grown 18 hours at 30C
  • Spin down, resuspend in 45 ml EPB
  • again
  • again, in 20 ml
  • spin down, resuspend in remaining liquid, bring to 250 ul
  • add 35 ul 80% glycerol
  • Aliquot to 50 ul tubes
  • flash freeze in EtOH + dry ice


Retrieved from "https://openwetware.org/mediawiki/index.php?title=User:Tk/Notebook/MF-xfm/2008/04/08&oldid=213990"