User:Stuart McKellar/Notebook/Bird Sex Testing/2013/01/04 - Revision history

Stuart McKellar: /* Temps and new primers */

Stuart McKellar — Tue, 08 Jan 2013 23:16:28 GMT

Temps and new primers

←Older revision		Revision as of 23:16, 8 January 2013
Line 23:		Line 23:

	also, this paper suggests using some new primers and was getting results very similar to my ones. Going to try and order NP an MP primers. See this paper for what a positive and negative result looks like using P2/P8 primers.		also, this paper suggests using some new primers and was getting results very similar to my ones. Going to try and order NP an MP primers. See this paper for what a positive and negative result looks like using P2/P8 primers.
		+
		+	NP primer:
		+	5’-GAG AAA CTG TGC AAAACA G-3’
		+
		+	MP primer:
		+	5’-AGT CAC TAT CAG ATC CGG AA-3’

	Also this page suggests using 1μL of 10μM primer to give final concentration of 0.5μM in 20μL. Maybe I should start running the reactions at 20ul instead.		Also this page suggests using 1μL of 10μM primer to give final concentration of 0.5μM in 20μL. Maybe I should start running the reactions at 20ul instead.

Stuart McKellar: /* Temps and new primers */

Stuart McKellar — Fri, 04 Jan 2013 01:30:58 GMT

Temps and new primers

←Older revision		Revision as of 01:30, 4 January 2013
Line 31:		Line 31:
	ITS4 5'-TCCTCCGCTTATTGATATGC-3' reverse all		ITS4 5'-TCCTCCGCTTATTGATATGC-3' reverse all

-		+	'''EDIT THESE PAGES TO SEE NICE FORMATTING'''
	<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->		<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
	\|}		\|}

	__NOTOC__		__NOTOC__

Stuart McKellar: /* Temps and new primers */

Stuart McKellar — Fri, 04 Jan 2013 01:29:16 GMT

Temps and new primers

←Older revision		Revision as of 01:29, 4 January 2013
Line 24:		Line 24:
	also, this paper suggests using some new primers and was getting results very similar to my ones. Going to try and order NP an MP primers. See this paper for what a positive and negative result looks like using P2/P8 primers.		also, this paper suggests using some new primers and was getting results very similar to my ones. Going to try and order NP an MP primers. See this paper for what a positive and negative result looks like using P2/P8 primers.

		+	Also this page suggests using 1μL of 10μM primer to give final concentration of 0.5μM in 20μL. Maybe I should start running the reactions at 20ul instead.
		+
		+
		+	Mushy primers:
		+	ITS1 5'-TCCGTAGGTGAACCTGCGG-3' forward all
		+	ITS4 5'-TCCTCCGCTTATTGATATGC-3' reverse all

Stuart McKellar: /* Entry title */

Stuart McKellar — Fri, 04 Jan 2013 00:54:39 GMT

Entry title

←Older revision		Revision as of 00:54, 4 January 2013
Line 6:		Line 6:
	\| colspan="2"\|		\| colspan="2"\|
	<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->		<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->
-	==~~Entry title~~==	+	==Reconciling information and thoughts after break==
-	* Insert content here...	+
		+	I did some reading and thinking and research during the xmas break. This is the result.
		+
		+	=Housekeeping Genes=
		+
		+	Finally found some housekeeping primers:
		+	18S-F908 18S a AGCGAAAGCATTTGCCAAGA 401 This study (SVB)
		+	18S-R1309 18S a AGTCTCGTTCGTTATCGGAATT This study (SVB)
		+
		+	(from http://wwwnc.cdc.gov/eid/article/11/5/05-0211-t1.htm)
		+
		+	=Temps and new primers=
		+	P2/P8 primers work best at 60C, confirming my lab work.
		+	(from http://www.academia.edu/1460726/Sex_Identification_of_Some_Pet_Birds_by_Polymerase_Chain_Reaction-Based_Methods )
		+
		+	also, this paper suggests using some new primers and was getting results very similar to my ones. Going to try and order NP an MP primers. See this paper for what a positive and negative result looks like using P2/P8 primers.
		+

Stuart McKellar: Autocreate 2013/01/04 Entry for User:Stuart_McKellar/Notebook/Bird_Sex_Testing

Stuart McKellar — Fri, 04 Jan 2013 00:39:20 GMT

Autocreate 2013/01/04 Entry for User:Stuart_McKellar/Notebook/Bird_Sex_Testing

New page

{|{{table}} width="800"
|-
|style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;"> Project name</span>
|style="background-color: #F2F2F2" align="center"|<html><img src="/images/9/94/Report.png" border="0" /></html> [[{{#sub:{{FULLPAGENAME}}|0|-11}}|Main project page]]<br />{{#if:{{#lnpreventry:{{FULLPAGENAME}}}}|<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>[[{{#lnpreventry:{{FULLPAGENAME}}}}{{!}}Previous entry]]<html>      </html>}}{{#if:{{#lnnextentry:{{FULLPAGENAME}}}}|[[{{#lnnextentry:{{FULLPAGENAME}}}}{{!}}Next entry]]<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>}}
|-
| colspan="2"|

==Entry title==
* Insert content here...


|}

__NOTOC__