User:Stuart McKellar/Notebook/Bird Sex Testing/2013/01/04
From OpenWetWare
(→Entry title) |
(→Temps and new primers) |
||
| Line 24: | Line 24: | ||
also, this paper suggests using some new primers and was getting results very similar to my ones. Going to try and order NP an MP primers. See this paper for what a positive and negative result looks like using P2/P8 primers. | also, this paper suggests using some new primers and was getting results very similar to my ones. Going to try and order NP an MP primers. See this paper for what a positive and negative result looks like using P2/P8 primers. | ||
| + | Also this page suggests using 1μL of 10μM primer to give final concentration of 0.5μM in 20μL. Maybe I should start running the reactions at 20ul instead. | ||
| + | |||
| + | |||
| + | Mushy primers: | ||
| + | ITS1 5'-TCCGTAGGTGAACCTGCGG-3' forward all | ||
| + | ITS4 5'-TCCTCCGCTTATTGATATGC-3' reverse all | ||
Revision as of 21:29, 3 January 2013
 Project name
|  Main project page Previous entry Next entry
|
Reconciling information and thoughts after breakI did some reading and thinking and research during the xmas break. This is the result. Housekeeping GenesFinally found some housekeeping primers: 18S-F908 18S a AGCGAAAGCATTTGCCAAGA 401 This study (SVB) 18S-R1309 18S a AGTCTCGTTCGTTATCGGAATT This study (SVB) (from http://wwwnc.cdc.gov/eid/article/11/5/05-0211-t1.htm) Temps and new primersP2/P8 primers work best at 60C, confirming my lab work. (from http://www.academia.edu/1460726/Sex_Identification_of_Some_Pet_Birds_by_Polymerase_Chain_Reaction-Based_Methods ) also, this paper suggests using some new primers and was getting results very similar to my ones. Going to try and order NP an MP primers. See this paper for what a positive and negative result looks like using P2/P8 primers. Also this page suggests using 1μL of 10μM primer to give final concentration of 0.5μM in 20μL. Maybe I should start running the reactions at 20ul instead.
| |
