User:Stuart McKellar/Notebook/Bird Sex Testing/2013/01/04

From OpenWetWare
Jump to navigationJump to search
The printable version is no longer supported and may have rendering errors. Please update your browser bookmarks and please use the default browser print function instead.
Project name <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Reconciling information and thoughts after break

I did some reading and thinking and research during the xmas break. This is the result.

Housekeeping Genes

Finally found some housekeeping primers: 18S-F908 18S a AGCGAAAGCATTTGCCAAGA 401 This study (SVB) 18S-R1309 18S a AGTCTCGTTCGTTATCGGAATT This study (SVB)

(from http://wwwnc.cdc.gov/eid/article/11/5/05-0211-t1.htm)

Temps and new primers

P2/P8 primers work best at 60C, confirming my lab work. (from http://www.academia.edu/1460726/Sex_Identification_of_Some_Pet_Birds_by_Polymerase_Chain_Reaction-Based_Methods )

also, this paper suggests using some new primers and was getting results very similar to my ones. Going to try and order NP an MP primers. See this paper for what a positive and negative result looks like using P2/P8 primers.

Also this page suggests using 1μL of 10μM primer to give final concentration of 0.5μM in 20μL. Maybe I should start running the reactions at 20ul instead.


Mushy primers: ITS1 5'-TCCGTAGGTGAACCTGCGG-3' forward all ITS4 5'-TCCTCCGCTTATTGATATGC-3' reverse all

EDIT THESE PAGES TO SEE NICE FORMATTING