User:Stuart McKellar/Notebook/Bird Sex Testing/2013/01/04
Project name | <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page <html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html> </html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html> |
Reconciling information and thoughts after breakI did some reading and thinking and research during the xmas break. This is the result. Housekeeping GenesFinally found some housekeeping primers: 18S-F908 18S a AGCGAAAGCATTTGCCAAGA 401 This study (SVB) 18S-R1309 18S a AGTCTCGTTCGTTATCGGAATT This study (SVB) (from http://wwwnc.cdc.gov/eid/article/11/5/05-0211-t1.htm) Temps and new primersP2/P8 primers work best at 60C, confirming my lab work. (from http://www.academia.edu/1460726/Sex_Identification_of_Some_Pet_Birds_by_Polymerase_Chain_Reaction-Based_Methods ) also, this paper suggests using some new primers and was getting results very similar to my ones. Going to try and order NP an MP primers. See this paper for what a positive and negative result looks like using P2/P8 primers. Also this page suggests using 1μL of 10μM primer to give final concentration of 0.5μM in 20μL. Maybe I should start running the reactions at 20ul instead.
|