User:Stuart McKellar/Notebook/Bird Sex Testing/2013/01/04

From OpenWetWare

< User:Stuart McKellar | Notebook | Bird Sex Testing | 2013 | 01(Difference between revisions)
Jump to: navigation, search
(Temps and new primers)
Current revision (18:16, 8 January 2013) (view source)
(Temps and new primers)
 
Line 23: Line 23:
also, this paper suggests using some new primers and was getting results very similar to my ones. Going to try and order NP an MP primers. See this paper for what a positive and negative result looks like using P2/P8 primers.
also, this paper suggests using some new primers and was getting results very similar to my ones. Going to try and order NP an MP primers. See this paper for what a positive and negative result looks like using P2/P8 primers.
 +
 +
NP primer:
 +
5’-GAG AAA CTG TGC AAAACA G-3’
 +
 +
MP primer:
 +
5’-AGT CAC TAT CAG ATC CGG AA-3’
Also this page suggests using 1μL of 10μM primer to give final concentration of 0.5μM in 20μL. Maybe I should start running the reactions at 20ul instead.
Also this page suggests using 1μL of 10μM primer to give final concentration of 0.5μM in 20μL. Maybe I should start running the reactions at 20ul instead.

Current revision

Project name Main project page
Previous entry      Next entry

Reconciling information and thoughts after break

I did some reading and thinking and research during the xmas break. This is the result.

Housekeeping Genes

Finally found some housekeeping primers: 18S-F908 18S a AGCGAAAGCATTTGCCAAGA 401 This study (SVB) 18S-R1309 18S a AGTCTCGTTCGTTATCGGAATT This study (SVB)

(from http://wwwnc.cdc.gov/eid/article/11/5/05-0211-t1.htm)

Temps and new primers

P2/P8 primers work best at 60C, confirming my lab work. (from http://www.academia.edu/1460726/Sex_Identification_of_Some_Pet_Birds_by_Polymerase_Chain_Reaction-Based_Methods )

also, this paper suggests using some new primers and was getting results very similar to my ones. Going to try and order NP an MP primers. See this paper for what a positive and negative result looks like using P2/P8 primers.

NP primer: 5’-GAG AAA CTG TGC AAAACA G-3’

MP primer: 5’-AGT CAC TAT CAG ATC CGG AA-3’

Also this page suggests using 1μL of 10μM primer to give final concentration of 0.5μM in 20μL. Maybe I should start running the reactions at 20ul instead.


Mushy primers: ITS1 5'-TCCGTAGGTGAACCTGCGG-3' forward all ITS4 5'-TCCTCCGCTTATTGATATGC-3' reverse all

EDIT THESE PAGES TO SEE NICE FORMATTING


Personal tools