User:Sithara Thalluri/Notebook/Biology 210 at AU: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
 
(52 intermediate revisions by 2 users not shown)
Line 1: Line 1:
'''1/28/15'''
== PCR DATA ==
== Lab 2: Identifying Algae and Protists ==


[[Purpose]]: The purpose of this lab was to practice using a dichotomous key while observing our hay infusion cultures. Also in this lab we learned how to prepare and plate serial dilutions.  
'''Purpose''': The purpose of this lab was to isolate DNA samples of bacteria from our transect, and use primers and PCR to amplify the 16S rRNA gene in order to correctly identify bacteria.  


[[Materials and Methods]]:
'''Materials and Methods''': Students transferred a single colony of bacteria to a 100 μL of water in a sterile tube. The tubes were then incubated at 100°C for 10 minutes in a heating block, floating in water. Samples were then centrifuged for 5 minutes at 13,400 rpm. While samples were centrifuged, 20 μL of a primer and water solution was added to a labeled PCR tube and mixed to dissolve the PCR bead. Then, 5 μL of the supernatant from the centrifuged samples were transferred to the 16S PCR reaction and placed in to the PCR machine. A week later, students ran PCR products on an agarose gel. Then samples were sequenced and able to be identified.
''Procedure 1'': In the first part of lab we observed pre-plated organisms and and attempted to sort them according to the dichotomous key. We also
made wet mounts of known organism and then observed them. We made these observations under a 4X then 10X.  


''Procedure 2'': In this part of the lab we examined our hay infusions from last week's lab. Once obtained, we noted the appearance and smell of our hay infusions (made with components of our assigned transects). We then extracted two different samples from our hay infusions - each representing a different layer or niche of our jar - and then prepared two wet mounts with each sample. Then, using the dichotomous key, we found three different organisms in each of our two 'habitats' from the top and bottom of the culture.
'''Data and Observations'''


''Procedure 3'': In the last part of lab we did a serial dilution with 10mLs of sterile broth and samples of our hay infusions. In the dilution, we labeled four test tubes containing 10mLs of sterile broth with 10^-2, 10^-4, 10^-6, and 10^-8. We then obtained four agar plates, and four agar plates with tetracycline - and labeled those respectively as containing tetracycline or not, while also labeling them 10^-3, 10^-5, 10^-7, and 10^-9. We then added 100µl of our hay infusion culture to the 10mL of sterile broth labeled 10^-2. Then we added 100µl of the swirled tube labeled 10^-2 to the tube labeled 10^-4, and repeated the steps on the remaining two tubes. Then we needed to plate our dilutions. To do so we we used a pipette, spreading rod, alcohol bath, and an open flame (the last two items were used for sterilization performed after every plating of the spreading rod). We used the pipette to add 100µl from the 10^-2 tube to the agar plates (with tetracycline and w/o) labeled 10^-3 - and we repeated this step with each increasing number. Then we carefully wrapped the plated in aluminum foil and let them sit on a rack.  
>MB47-For_16S_G06.ab1
NNNNNNNNNNNNNNNNNCTNNNCNTGCAGCCGAGCGGTAGAGATTCTTCGGAATCTTGAGAGCGGCGCACGGGTGCGGAA
CACGTGTGCAACCTGCCTTTATCAGGGGAATAGCCTTTCGAAAGGAAGATTAATGCCCCATAATATATCATATGGCATCA
TTTGATATTGAAAACTCCGGTGGATAAAGATGGGCACGCGCAGGATTAGATAGTTGGTAGGGTAACGGCCTACCAAGTCA
GCGATCCTTAGGGGGCCTGAGAGGGTGATCCCCCACACTGGTACTGAGACACGGACCAGACTCCTACGGGAGGCAGCAGT
GAGGAATATTGGACAATGGGTGAGAGCCTGATCCAGCCATCCCGCGTGAAGGACGACGGCCCTATGGGTTGTAAACTTCT
TTTGTATAGGGATAAACCTACCCTCGTGAGGGTAGCTGAAGGTACTATACGAATAAGCACCGGCTAACTCCGTGCCAGCA
GCCGCGGTAATACGGAGGGTGCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTCCGTANGCTGATGTGTAANTCANTG
GTGAAATCTCACANCTTANCTGTGAAACTGCCNTTGATACTGCATGTCTTGAGTGTTGTTGAANTANCTGGAATAANTNN
GTANCAGTGAAATGCCTANATATTACTTNNANCACNANGTGCTAANGCANGTTGGTANNCCNCNACTGACNCTGATNGAG
NAAANCNTGGGNNAGCGAACANAANTNNATACCCTGGGGNNGTNNNCNNNAANNAANCTNANTCNNTTTTTNTCTTTCTC
TTNCNNATACANNNNNANCCGANAAGNTNGCCNNCTNCCGGGTGGTGTTCTCCNTNNTNNNGATGNNNTCNNCTNNNNNN
NNNNNCNGCCCCCCCNCAANNATTTNTANANNNNTATANNNTNNNANANCNNGCGGCCCCCTNTNTAANNGGNNNNGGGG
GAGNNNNNNGNNNNNGTTTTCTATTATATNTNNNNCTNTNNNCCNCNNGNNCNGGGGGGGTTGTNTCTCCCNNCCAGAAC
NNAANGANANTNTNCNNCANCAGCCNNNN


[[Image: IMG_5887.jpeg]]
Chrseobacterium (above): MB 47


[[Data and Observations]]: When we brought back our hay infusion we noted that it had no noticeable scent. It was a brown and green murky color and had tan clusters of film present on the top. We obtained three organisms from the top, chilomonas (22um), colpidium(51 um), and paramecium aurelia (156um). All three of these organisms were motile, and protozoa - thus making them non-photosynthetic.  
>MB48-For_16S_H06.ab1
NNNNNNNNNNNNNNGCNNANNNTGNNANNNNNGCGGTANGANGGGANGCTTGCTCTNNGATTCAGCGGCGGACGGGTGAG
TAATGCCTAGGAATCTGCCTGGTAGTGGGGGACAACGTTTCGAAAGGAACGCTAATACCGCATACGTCCTACGGGAGAAA
GCAGGGGACCTTCGGGCCTTGCGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTGGTGAGGTAATGGCTCACCAAGGC
GACGATCCGTAACTGGTCTGAGAGGATGATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAG
TGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGTCTTCGGATTGTAAAGCACT
TTAAGTTGGGAGGAAGGGCATTAACCTAATACCTTGGTGTTTTGACGTTACCGACAGAATAAGCACCGGCTAACTCTGTG
CCAGCAGCCGCGGTAATACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTANGTGGTTTGTTAAG
TTGGATGTGAAAGCCCCGGGCTCAACCTGGGAACTGCNTTCNAAACTGNCNAGCTAGAGTATGGTANAGGGTGGTGGAAT
TTCCTGTGTAGCNNTGAAATGCGTAGATATANGAANGAACACNNNGTGGCNAAGCGGACCACCTGNACTGATACTNACAC
TGANNTGCGAAANNNTGTGGANCAAACANNATTANGATNNCCTNNAGTCCACNGCCNGTANACNNNNTCAACTANCNNNN
NNAGCNCTTNANNTGTTANTGNCGCNNCTAACNCATTAANTNNCNNCGCTGGNTNNGTAGNAGNCCNCGNCCGTTAGNNC
TNNNNNNGGAGTTNANNGGNGCCNNGCACAAGCNACTGNAGCAGGGNGGGNTGTAGTTCCNAANNNNNNACNAAAAANNN
NNACCCNGNCCCTNGGNATNNAANNNAGNNNNNGAGGNNNNNNAANNNGNGNNNNGGNTGNNNNCNNNGGAAANNNNACC
ANNNGNNNATGGTNGGNNNNNNNCNNCANNNNNNCNANCCCNNNNNNN


These images are of the organisms respectively :
Pseudomonas MB 48
[[Image:IMG_0891.jpeg]]
[[Image:IMG_0890.jpeg]]
[[Image:IMG_3348.jpeg]]


From the bottom sample of our hay infusion we found peranema (45 um), arcella (63um), and paramecium bursaria (156um). These organism were also all motile, non-photosynthesizing protozoa.


These are images of the organisms respectively:
'''Conclusions'''
[[Image:IMG_5072.jpeg]]
In conclusion, the 16s sequencing which identified the bacteria matched with previous attained observations, although generally poor in quality.
[[Image:IMG_0888.JPG]]
[[Image:IMG_0889.JPG]]
For the first sequence, it is determined that the species of bacteria was Chryseobacterium. This is in agreeance with previous observations: chryseobacterium is gram negative, circular, and slow motility. The colors of the bacterium is variable, but includes the white color observed.
 
In the second sequence it was determined that the bacteria was Pseudomonas aeruginosa. Pseudomonas are fairly motile, bacillus or coccus in shape and are gram negative - this is in accordance with previous observations as well.  
 
== Lab #6 Zebrafish ==
 
'''Purpose''': The purpose of this lab is to learn the stages of embryonic development, compare embryonic development in different organisms, and set up an experiment to study how environmental conditions affect embryonic development.  


[[Conclusions and Future Directions]]: This weeks lab really emphasized the scale of organisms, and illustrated the wide spectrum of life present just on our own campus. For instance, and organism such a paramecium meets all the needs of life: energy, cells, replication, information, and evolution.  
'''Materials and Methods''': Students first read a published paper about the affect of their given treatment, in this case - nicotine, on zebrafish embryos. From these papers we were able to make predictions, hypotheses, and experimental plans. On the first day of the experiment, students set up two groups of zebrafish, a test group and a treated group - thus tested only one variable, nicotine. To do so, two petri dishes were acquired. One dish was filled with distilled water, and the other filled with pre-made nicotine solution. Then 20 healthy translucent embryos were placed in each petri dish. An observation schedule was arranged.


'''Data and Observations'''




{| {{table}}
| align="center" style="background:#f0f0f0;"|'''Control'''
| align="center" style="background:#f0f0f0;"|'''Day 0 (2/19)'''
| align="center" style="background:#f0f0f0;"|'''Day 1 (2/20)'''
| align="center" style="background:#f0f0f0;"|'''Day 4 (2/23)'''
| align="center" style="background:#f0f0f0;"|'''Day 7 (2/26)'''
| align="center" style="background:#f0f0f0;"|'''Day 11 (3/2)'''
| align="center" style="background:#f0f0f0;"|'''Day 13 (3/4)'''
|-
| # of Dead Eggs||0||0||4||1||0||0
|-
| # of Live Eggs||20||20||8||0||0||0
|-
| # of Live Hatchings||0||0||5||10||9||9
|-
| # of Dead Hatchlings||0||0||0||1||1||0
|-
| Stages of Development||Zygote||Zygote||8-->25-somites, 5--> high spec||10--> protuding mouth||-||0
|-
| # Disappeared||0||0||3||0||0||0
|-
| Degree of Body/Tail Pigmentation||-||-||-||-||yellow, with black dots, straight||bits of yellow by head, blacks spots down body, striaght
|-
| ||||||||||||tail= 28.7 5μm body=41.25 μm
|-
| Eyes/Eye Movement||-||-||-||-||strong, fast||rapid eye movement, eyes= 2.5 μm
|-
| Heart Rate||-||-||-||-||-||56 bpm
|-
| General Movement||-||-||-||-||jittery movement, fast reaction time (1sec)||constantly moving, fast reaction time (1sec)
|-
| Feces||-||-||-||-||mild, few piles (5)||4 piles
|-
| ||||||||-||||
|-
| align="center" style="background:#f0f0f0;"|'''Treated with Nicotine'''
| align="center" style="background:#f0f0f0;"|'''Day 0 (2/19)'''
| align="center" style="background:#f0f0f0;"|'''Day 1 (2/20)'''
| align="center" style="background:#f0f0f0;"|'''Day 4 (2/23)'''
| align="center" style="background:#f0f0f0;"|'''Day 7 (2/26)'''
| align="center" style="background:#f0f0f0;"|'''Day 11 (3/2)'''
| align="center" style="background:#f0f0f0;"|'''Day 13 (3/4)'''
|-
| # of Dead Eggs||0||6||5||0||0||0
|-
| # of Live Eggs||20||20 (added 6)||1||1||0||0
|-
| # of Live Hatchings||0||0||10||9||8||5
|-
| # of Dead Hatchlings||0||0||0||0||0||0
|-
| Stages of Development||Zygote||17-somites||1--> 21 somites, 10--> high spec||1-->25-somite 9--> protuding mouth||0||3
|-
| #  Disappeared ||0||0||4||1||2||0
|-
| Degree of Body/Tail Pigmentation||-||-||-||-|| either much more yellow w/  black dots or not yellow with black dots||body bent, minimum yellow,most clear with black dots down back
|-
| ||||||||||body was bent||tail=25 μm body= 40 μm
|-
| Eyes/Eye Movement||-||-||-||-||slow, delayed||no eye movement, eyes=2.75 μm
|-
| Heart Rate||-||-||-||-||-||60 bpm
|-
| General Movement||-||-||-||-||float around, very slow reaction time (3 sec)||floating, not much movement, slow reaction time(3), one was crazy
|-
| Feces||-||-||-||-||Lots of piles (20)||lots of piles (25)


'''1.27.15'''
Good first entry. Need to include more detail for example there is no mention of the Hay Infusion set-up. Pictures would add information. The transect was 20Ft by 20Ft, not meters, there is a typo in the manual.
SK




'''1/26/15'''
| ||Tail||Body||Eye||General Observations||||
== Lab 1: Biological Life at AU ==
|-
| Fixed Control||25 μm ||37.5 μm ||3.75 μm ||furry, clear no black dots, moldy?||||
|-
| Fixed Treated||25 μm ||42.5 μm ||2.75 μm ||bent, black dots on back||||
|}
 
[[Image:800px-IMG 1124.JPG]]
The above image shows a Zebrafish treated with nicotine at day 4, 25 somite
[[Image:600px-IMG 1237.JPG]]
This image shows a fixed control Zebrafish
[[Image:600px-IMG 1238.JPG]]
This image shows a fixed treated with nicotine Zebrafish
[[Image:800px-IMG 1141.JPG]]
This images shows a high spec control Zebrafish
[[Image:800px-IMG 1169.JPG]]
This image shows a high spec treated Zebrafish
 
'''Conclusions and Future Directions'''
Past research concluded that placing zebrafish embryos in a nicotine solution would negatively impact their survival rate through reduces their response time, eye diameter, tail length, and heart rate. In accordance to past experiments, the zebrafish treated with the nicotine solution had a higher mortality rate as well as reductions in other physical traits crucial to survival.
 
 
 
 
'''2.20.15'''
Very good lab book entry.
Detailed description of procedures and invertebrates found. Well organized, especially the contents section at the top. Nice food web and good consideration of the fence at transect.
'''SK'''
 
== Lab #5 Invertebrates ==
 
'''Purpose'''
The purpose of this lab was to observe invertebrates in order to understand their importance and to learn how simple systems evolved in to more complex systems.
 
'''Materials and Methods'''
 
''Procedure I'': In the first procedure students observed prepared slides of cross sections of Acoelomates, Psuedocoelomates, and Coelomates under a microscope and noticed their movement mechanisms and other body structures.
 
''Procedure II'': During this procedure, students observed example organisms from the classes: Arachnida, Diplopoda, Chilopoda, Insect, and Crustacea. Students observed the differences in these organisms such as body parts, body segments, and number of appendages.
 
''Procedure III'': In procedure three, students analyzed the invertebrates that were collected from our given transects through the breaking down of Berlese Funnels. First, students poured the top 10-15 mLs of the funnel liquid in to a petri dish, then the remaining liquid in to another - labeling them top and bottom respectively. Students then examined each petri dish under a microscope and identified each organism using a key.
 
''Procedure IV'': Finally students considered vertebrates that inhabit and pass through their given transects and analyzed their presence in the transect - which is explained further in the data below.


Purpose:  The purpose of this lab is to observe and analyze the ecological interactions occurring in our given “niches” represented by a 20 x 20 meter transect of land somewhere on campus. We will explore the sheer amount of biological diversity present just within American University’s campus alone through weekly visits to our given niches.
Materials and Methods: Each group was assigned a transect of land that is 20 x 20 meters large and we are responsible for observing and analyzing the ecology of the environment and recording data. The transect of land is the AU student run community garden behind Leonard Hall next to the campus tennis courts. We are responsible for weekly observations of our plot and data recording.
Data and Observations: We observed the agricultural nature of the transect which included an irrigation system(hoses running through each separate garden box), presumably fertilized soil(only in the garden boxes), and of courseseparate wooden garden boxes for each different plant. The plants present in our transect of the garden are brussel sprouts, lettuce, kale, and cucumbers. In addition to the more uniformed boxes, there is an area of stray leaves, mulch, and hay on the edge of our transect.
Biotic features of our transect included things such as: pests, rodents, birds, weeds, vegetables, earthworms, etc. While abiotic features included: air, water, soil, mulch, etc. One prominent factor that will determine the state of our transect is human interaction because it is a garden that depends on irrigation and human maintenance.


Conclusions and Future Directions: I think it will be interesting to observe the qualities in our transect in contrast to the more naturally occurring transects that students have - as our transect is so influenced by humans. I also am interested to see the interactions between the vegetables and the attraction of pests to the garden.
'''Data and Observations'''


'''1/22/15'''
[[The table below show
Test

Latest revision as of 07:02, 26 March 2015

PCR DATA

Purpose: The purpose of this lab was to isolate DNA samples of bacteria from our transect, and use primers and PCR to amplify the 16S rRNA gene in order to correctly identify bacteria.

Materials and Methods: Students transferred a single colony of bacteria to a 100 μL of water in a sterile tube. The tubes were then incubated at 100°C for 10 minutes in a heating block, floating in water. Samples were then centrifuged for 5 minutes at 13,400 rpm. While samples were centrifuged, 20 μL of a primer and water solution was added to a labeled PCR tube and mixed to dissolve the PCR bead. Then, 5 μL of the supernatant from the centrifuged samples were transferred to the 16S PCR reaction and placed in to the PCR machine. A week later, students ran PCR products on an agarose gel. Then samples were sequenced and able to be identified.

Data and Observations

>MB47-For_16S_G06.ab1 NNNNNNNNNNNNNNNNNCTNNNCNTGCAGCCGAGCGGTAGAGATTCTTCGGAATCTTGAGAGCGGCGCACGGGTGCGGAA CACGTGTGCAACCTGCCTTTATCAGGGGAATAGCCTTTCGAAAGGAAGATTAATGCCCCATAATATATCATATGGCATCA TTTGATATTGAAAACTCCGGTGGATAAAGATGGGCACGCGCAGGATTAGATAGTTGGTAGGGTAACGGCCTACCAAGTCA GCGATCCTTAGGGGGCCTGAGAGGGTGATCCCCCACACTGGTACTGAGACACGGACCAGACTCCTACGGGAGGCAGCAGT GAGGAATATTGGACAATGGGTGAGAGCCTGATCCAGCCATCCCGCGTGAAGGACGACGGCCCTATGGGTTGTAAACTTCT TTTGTATAGGGATAAACCTACCCTCGTGAGGGTAGCTGAAGGTACTATACGAATAAGCACCGGCTAACTCCGTGCCAGCA GCCGCGGTAATACGGAGGGTGCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTCCGTANGCTGATGTGTAANTCANTG GTGAAATCTCACANCTTANCTGTGAAACTGCCNTTGATACTGCATGTCTTGAGTGTTGTTGAANTANCTGGAATAANTNN GTANCAGTGAAATGCCTANATATTACTTNNANCACNANGTGCTAANGCANGTTGGTANNCCNCNACTGACNCTGATNGAG NAAANCNTGGGNNAGCGAACANAANTNNATACCCTGGGGNNGTNNNCNNNAANNAANCTNANTCNNTTTTTNTCTTTCTC TTNCNNATACANNNNNANCCGANAAGNTNGCCNNCTNCCGGGTGGTGTTCTCCNTNNTNNNGATGNNNTCNNCTNNNNNN NNNNNCNGCCCCCCCNCAANNATTTNTANANNNNTATANNNTNNNANANCNNGCGGCCCCCTNTNTAANNGGNNNNGGGG GAGNNNNNNGNNNNNGTTTTCTATTATATNTNNNNCTNTNNNCCNCNNGNNCNGGGGGGGTTGTNTCTCCCNNCCAGAAC NNAANGANANTNTNCNNCANCAGCCNNNN

Chrseobacterium (above): MB 47

>MB48-For_16S_H06.ab1 NNNNNNNNNNNNNNGCNNANNNTGNNANNNNNGCGGTANGANGGGANGCTTGCTCTNNGATTCAGCGGCGGACGGGTGAG TAATGCCTAGGAATCTGCCTGGTAGTGGGGGACAACGTTTCGAAAGGAACGCTAATACCGCATACGTCCTACGGGAGAAA GCAGGGGACCTTCGGGCCTTGCGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTGGTGAGGTAATGGCTCACCAAGGC GACGATCCGTAACTGGTCTGAGAGGATGATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAG TGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGTCTTCGGATTGTAAAGCACT TTAAGTTGGGAGGAAGGGCATTAACCTAATACCTTGGTGTTTTGACGTTACCGACAGAATAAGCACCGGCTAACTCTGTG CCAGCAGCCGCGGTAATACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTANGTGGTTTGTTAAG TTGGATGTGAAAGCCCCGGGCTCAACCTGGGAACTGCNTTCNAAACTGNCNAGCTAGAGTATGGTANAGGGTGGTGGAAT TTCCTGTGTAGCNNTGAAATGCGTAGATATANGAANGAACACNNNGTGGCNAAGCGGACCACCTGNACTGATACTNACAC TGANNTGCGAAANNNTGTGGANCAAACANNATTANGATNNCCTNNAGTCCACNGCCNGTANACNNNNTCAACTANCNNNN NNAGCNCTTNANNTGTTANTGNCGCNNCTAACNCATTAANTNNCNNCGCTGGNTNNGTAGNAGNCCNCGNCCGTTAGNNC TNNNNNNGGAGTTNANNGGNGCCNNGCACAAGCNACTGNAGCAGGGNGGGNTGTAGTTCCNAANNNNNNACNAAAAANNN NNACCCNGNCCCTNGGNATNNAANNNAGNNNNNGAGGNNNNNNAANNNGNGNNNNGGNTGNNNNCNNNGGAAANNNNACC ANNNGNNNATGGTNGGNNNNNNNCNNCANNNNNNCNANCCCNNNNNNN

Pseudomonas MB 48


Conclusions In conclusion, the 16s sequencing which identified the bacteria matched with previous attained observations, although generally poor in quality.

For the first sequence, it is determined that the species of bacteria was Chryseobacterium. This is in agreeance with previous observations: chryseobacterium is gram negative, circular, and slow motility. The colors of the bacterium is variable, but includes the white color observed.

In the second sequence it was determined that the bacteria was Pseudomonas aeruginosa. Pseudomonas are fairly motile, bacillus or coccus in shape and are gram negative - this is in accordance with previous observations as well.

Lab #6 Zebrafish

Purpose: The purpose of this lab is to learn the stages of embryonic development, compare embryonic development in different organisms, and set up an experiment to study how environmental conditions affect embryonic development.

Materials and Methods: Students first read a published paper about the affect of their given treatment, in this case - nicotine, on zebrafish embryos. From these papers we were able to make predictions, hypotheses, and experimental plans. On the first day of the experiment, students set up two groups of zebrafish, a test group and a treated group - thus tested only one variable, nicotine. To do so, two petri dishes were acquired. One dish was filled with distilled water, and the other filled with pre-made nicotine solution. Then 20 healthy translucent embryos were placed in each petri dish. An observation schedule was arranged.

Data and Observations


Control Day 0 (2/19) Day 1 (2/20) Day 4 (2/23) Day 7 (2/26) Day 11 (3/2) Day 13 (3/4)
# of Dead Eggs 0 0 4 1 0 0
# of Live Eggs 20 20 8 0 0 0
# of Live Hatchings 0 0 5 10 9 9
# of Dead Hatchlings 0 0 0 1 1 0
Stages of Development Zygote Zygote 8-->25-somites, 5--> high spec 10--> protuding mouth - 0
# Disappeared 0 0 3 0 0 0
Degree of Body/Tail Pigmentation - - - - yellow, with black dots, straight bits of yellow by head, blacks spots down body, striaght
tail= 28.7 5μm body=41.25 μm
Eyes/Eye Movement - - - - strong, fast rapid eye movement, eyes= 2.5 μm
Heart Rate - - - - - 56 bpm
General Movement - - - - jittery movement, fast reaction time (1sec) constantly moving, fast reaction time (1sec)
Feces - - - - mild, few piles (5) 4 piles
-
Treated with Nicotine Day 0 (2/19) Day 1 (2/20) Day 4 (2/23) Day 7 (2/26) Day 11 (3/2) Day 13 (3/4)
# of Dead Eggs 0 6 5 0 0 0
# of Live Eggs 20 20 (added 6) 1 1 0 0
# of Live Hatchings 0 0 10 9 8 5
# of Dead Hatchlings 0 0 0 0 0 0
Stages of Development Zygote 17-somites 1--> 21 somites, 10--> high spec 1-->25-somite 9--> protuding mouth 0 3
# Disappeared 0 0 4 1 2 0
Degree of Body/Tail Pigmentation - - - - either much more yellow w/ black dots or not yellow with black dots body bent, minimum yellow,most clear with black dots down back
body was bent tail=25 μm body= 40 μm
Eyes/Eye Movement - - - - slow, delayed no eye movement, eyes=2.75 μm
Heart Rate - - - - - 60 bpm
General Movement - - - - float around, very slow reaction time (3 sec) floating, not much movement, slow reaction time(3), one was crazy
Feces - - - - Lots of piles (20) lots of piles (25)


Tail Body Eye General Observations
Fixed Control 25 μm 37.5 μm 3.75 μm furry, clear no black dots, moldy?
Fixed Treated 25 μm 42.5 μm 2.75 μm bent, black dots on back

The above image shows a Zebrafish treated with nicotine at day 4, 25 somite This image shows a fixed control Zebrafish This image shows a fixed treated with nicotine Zebrafish This images shows a high spec control Zebrafish This image shows a high spec treated Zebrafish

Conclusions and Future Directions Past research concluded that placing zebrafish embryos in a nicotine solution would negatively impact their survival rate through reduces their response time, eye diameter, tail length, and heart rate. In accordance to past experiments, the zebrafish treated with the nicotine solution had a higher mortality rate as well as reductions in other physical traits crucial to survival.



2.20.15 Very good lab book entry. Detailed description of procedures and invertebrates found. Well organized, especially the contents section at the top. Nice food web and good consideration of the fence at transect. SK

Lab #5 Invertebrates

Purpose The purpose of this lab was to observe invertebrates in order to understand their importance and to learn how simple systems evolved in to more complex systems.

Materials and Methods

Procedure I: In the first procedure students observed prepared slides of cross sections of Acoelomates, Psuedocoelomates, and Coelomates under a microscope and noticed their movement mechanisms and other body structures.

Procedure II: During this procedure, students observed example organisms from the classes: Arachnida, Diplopoda, Chilopoda, Insect, and Crustacea. Students observed the differences in these organisms such as body parts, body segments, and number of appendages.

Procedure III: In procedure three, students analyzed the invertebrates that were collected from our given transects through the breaking down of Berlese Funnels. First, students poured the top 10-15 mLs of the funnel liquid in to a petri dish, then the remaining liquid in to another - labeling them top and bottom respectively. Students then examined each petri dish under a microscope and identified each organism using a key.

Procedure IV: Finally students considered vertebrates that inhabit and pass through their given transects and analyzed their presence in the transect - which is explained further in the data below.


Data and Observations

[[The table below show

Retrieved from "https://openwetware.org/mediawiki/index.php?title=User:Sithara_Thalluri/Notebook/Biology_210_at_AU&oldid=875472"