User:Sierra L. Stratton/Notebook/Biology 210 at AU

March 19th, 2015, Results of Zebrafish Embryos Exposed to a 2% Salt Solution

Purpose: The purpose of this lab was to follow an experiment that helps discover the various chemicals that may affect embryonic growth and development of Zebrafish. In this case 20 Zebrafish embryos were used as a control and 20 embryos were incubated in a chemical solution. The effects of the chemical on the embryos was determined through head to tail measurement, eye diameter, heart rate, and motility. A 2% salt solution was the experimental factor. The embryos were observed for two weeks and measurements were taken at different stages of development to check for abnormalities. From previous knowledge on what a high salt solution does to a cell it can be assumed that if the Zebrafish embryos are placed to incubate in the 2% salt solution then their embryonic development will be extremely limited. The development would be hindered due to the fact that when a cell is placed in a solution with a high concentration of salt the cell swells and bursts. The embryos would lack a suitable environment to survive and development would cease.

Materials and Methods: • A research paper on the effects of saline solutions on Zebrafish embryos was read for preparation of the experiment • A hypothesis and prediction were formed (stated in introduction) • 20 live embryos were placed into a petri dish, labeled as control dish, with 20mL of water • 20 live embryos were placed into a petri dish, labeled as 2% salt solution, with 20mL of a 2% salt solution • Lids were placed on both plates and were examined periodically • DAY 1 (2/20/15) Dead embryos and any egg casings were removed, number of surviving embryos were counted • DAY 4 (2/23/15) Dead embryos and egg casings were removed again, surviving Zebrafish were counted, and 10mL of solution or water was removed from the petri dishes and 25mL of either water or 2% salt solution was added to the respective dishes • DAY 7 (2/26/15) Dead Zebrafish were removed and one drop of Paramecium (food) was added to each dish. Representative larvae were observed from each dish with the aid of a microscope at the 4X objective. Degree of body, tail pigmentation, eye diameter, heart/heart rate, pectoral fin development, yolk sac size, development of the swim bladder, development of the mouth (protruding jaw), and general movement from an external stimulus were all noted and observed. Three larvae from each dish were taken and were put into respective a tube with tricaine solution. The TA later preserved the samples in paraformaldehyde and stored them. • DAY 14 (3/6/15) Length, eye diameter, fin development, and pigmentation of larvae were all observed. Live Zebrafish were placed in a “live” tank, dead Zebrafish were disposed of and the experiment was ended.

Results: DAY 1 (2/20,15) The control Zebrafish appeared to be at the 20 –somite stage of development, but when more closely examined the control showed the embryos to be at a 28 hour stage. The experimental group appeared to be behind at the 17-somite stage, with some at the 15 –somite stage. After day 1 of being in the petri dishes, 16/20 of the control fish were still alive and 17/20 of the salt solution fish were still alive.

Zebrafish Day 1(control L, Salt R)

DAY 4 (2/23/15) 14 of the Zebrafish in the control group were still alive on this day of observation. They responded well to external stimuli, there was tail movement, and larvae measured on average 3.5 mm long. All of the 2% salt solution embryos never hatched. The egg casings appeared to have burst open. Only 3 embryos were left alive.

Zebrafish Day 4

DAY 7 (2/26/15) All observation was done under 4X.The control group measured on average 4.2 mm and eye diameter was measured to be on average 0.175 mm. Pigmentation was a dark green color with a black spinal cord. Fin development of the larvae consisted of a small protrusion of cells, possibly the beginning of a growth of a dorsal fin. Organ development shows a spinal cord, however the body cavity was no longer clear so structures cannot be seen. Motility shows rapid swimming on a scale of 1 being slow and 10 being quite fast, fish exhibit an 8 with jolted movement. The experimental group showed a length of an egg casing, with all eggs appearing to have burst open but they are on average 1.25 mm in diameter. The pigmentation of the casings is clear.

DAY 14 (3/6/15) At this point in time, all of the samples in the control dish were dead. It was difficult to even locate bodies due to their state of deterioration. Observation was done under 4X. There was no motility of the fish all fish were deceased. One deteriorated body measured to be 1 mm and the eye diameter 0.1 mm. Pigmentation was a greenish black color. Organ development was hard to decipher due to deteriorating tissue.

Conclusions & Future Directions: In conclusion, the Zebrafish experiment showed different results for each group. However in this case all fish died in the experimental group and the control group before the experiment concluded. The passing of the fish in the experimental group was expected to occur at an early stage as previous experiments with Zebrafish and salt solutions concluded with fish by the turn of Blastulation and even Gastrulation stage. The fish in the control petri dish may have passed away due to lack of feedings or an unintentional alteration in environment such as spilling of their water. The petri dishes often leaked and were handled by almost all people in lab section 7, meaning there was a high possibility for water to get out. Future directions could possibly include conducting the days of the experiment throughout every single day of growth and not just certain days. Also snow days may have affected the results because then observation and care of the Zebrafish could not occur.

SLS

February 25th, 2015, 16 Sequence'

Purpose: The purpose of this lab was to identify the specific type of bacteria found in our transect.

Materials and Methods: • 16S sequence was derived from our serial dilutions of bacteria from Transect 3

• A single colony of bacteria was added to 100 microliters of water in a sterile tube

• Tubes were then incubated at 100 degrees Celsius for 10 minutes in a heat block

• Tubes were sampled centrifuged for 5 minutes at 13,400 rpm

• 20 microliters of a primer/water mixture was added to a labeled PCR tube, and tube was mixed until dissolved

• 5 microliters of supernatant liquid from centrifuged samples to the 16S PCR reaction tube

• Tube was placed in PCR machine

• A gel electrophoresis was run of our 16S PCR

• The two best samples were selected for 16S PCR Sequencing and were sent off and results were sent back

• Sequences were searched for in the BLAST database

• Specific types of bacteria were identified based off of the sequences

Data and Observations: The code for the bacterium were M57 and M58. There sequences were found on the GENEWIZ website. M57's and M58's sequences are as follows

Sequence of M57: >MB57-For_16S_A08.ab1 NNNNNNNNNGNNTNNAATGCANNCGANANGGAGCANNANTTGTCTGGGGGAGNGCGACGGGNGAGTNTATATCGGAACGT ACCCTANGTGGGGGATATCGTCTCGAAAGTTACGCTAATACCGCATACGATCTAAGGTGAAAGCGGGGGATCGCAAGACC TCGCGCTCGTGGAGCGGCCGATATCTGATTATATAGTTGGTANGATAAAAGCCTACCAAGGCGTCGATCTGTAGCTGGTC TGAGAGGACGACCAGCCACACTGGGACTGAGACACGGNCNAGACTCCTACGGGAGGCAGCAGTGGGGAATTTTGNACAAT GGGCGAAAGCCTGATCCANCAATGCCGCGTGNNNNNAGAAGGCCTTCGGGTTGTAAANCTCTTTTNTNNGGCNANGANAA GGNNGANAGCTAATANCCCNNTGGTTNTTGACGNTACCTNNAGAATAAGCACCGGCTNNNNTACTNTGNNANCAGCCGCG GATAATACNNNAGGNGTGCTNANNNGNNTNNTNNGGNNATNNANNTGNNGNNGTNANNNNNNNNGCCGCNNNGNNNGGGG TNTNNNTGNTNNANNANCNNNNANNNNNANNNNNNNNNCTNGNNCNTNNNNNCNNNTGGNGTGNNNNNNNNCNNNTNNNN NNNNNANNNNNNNNNNNNNNTANNNNNNTNANNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNTNTNNNNNNNNNNNNN NNNNNNNNNNGNNNNNAANNNNNTNNNCNNGTNAGTNNNNNNNNGGGNNNGGNNNNNNNNNCNNNNNCTGGNNNGNNNNN NNNNCNNNGNNNNNNNNNNNNNNNNNNNNNNNANCNNANNNNNNNNNNNNNNNNNN

Sequence of M58: >MB58-For_16S_B08.ab1 NNNNNNNNNNNNNNNNNNNNNGCNNNANTGCAGCCNANGGTNANTTCTTCGGATCTTGAACGGCNCATGGGTGCAGATCA CTTGNGTGNATTCATTTTCNNGTAGTATTCCNTGTNAATCNNCCNTCNNTTNCCNGNANACGACTTCTTTTTAGCCTTTG TGTTTTAAAGCACGAGGTTTAAATTCTTGTCGGCTACNTGGTTGATGGGGCGGGGGTATCTTCCCGCGANGGNNGNATCG TTNCGTNGTGAGNAAATANTCTTAGAGGNTGTGAAGAAAAAACGNNNGANANACNNGCGGGGTGNTNAGGGAGGAATAAT GNGGGNTGTGCGNAAANNGACTCCATCCCTCAGGCGTGAGGNNGGAGGGCAAGCTTTTTANNTN

M57 was found to be uncultured Oxalobacteraceae bacterium. Oxalobacteraceae bacterium is a gram-negative bacteria and it is a rod shaped bacteria, which matches our original observation of the bacteria under a microscope.

M58 was not originally found in the first search. Once the search parameters were set to only semi "specific" matches a match was found. It was found to be closely related to Mycoplasma yeatsii. However this match does not seem to make sense due to the fact that this particular bacteria comes from the ear canals of goats.

Conclusion and Future Direction: The one true match found with M57 was very promising. The particular bacteria present aids in Nitrogen fixation which makes sense that it was in an environment where many plants, that use nitrogen, live.

SLS

February 18th, 2015, Vertebrates

Purpose: In this lab vertebrates from transect three were examined and how those organisms interact with their environment, what their food web may be, and how they effect their environment.

Methods and Materials:

• Observed 5 vertebrates in transect three • Two species of birds and three mammals were chosen for observation • Organisms were classified from phylum to species • Biotic and Abiotic characteristics • Food web was constructed based on all organisms observed • Ecological concepts such as community, carrying capacity, and trophic levels were described

Data and Observations:

The vertebrates found in transect three were squirrels, raccoons, rats, sparrows, and grey cat birds.

Table One: Vertebrates Found in Transect Three

Vertebrate	Phylum	Genus	Order	Species
Squirrel	Chordate	Sciurus	Rodentia	S. carolinensis
Raccoon	Chordate	Procyon	Carnivora	P. lotor
Rat	Chordate	Rattus	Rodentia	R. norvegicus
Sparrow	Chordate	Spizella	Passeriformes	S. pusilla
Grey Catbird	Chordate	Dumetella	Passeriformes	D. carolinensis

Seeds, berries, and insects would benefit the birds. Insects, nuts, small mammals, and refuse from garbage cans containing food would benefit the other organisms. All the organisms require shelter, which the trees and bushes provide. Also the buildings cover their environment from harsh winds.

Photo One: Food Web of Transect Three

Data and Observation: All the organisms are connected to each other and depend on each other in their environment. The organisms with in their own environment form a community, they coexist in one specific area and have similar requirements for survival. In this community there is a specific carrying capacity of organisms, meaning there is only a certain number of organisms the environment can support with its resources available. The largest number of organisms in the environment are the primary producers like plants. The chain only goes up from there and gets smaller. It goes from primary producers to primary consumers to secondary consumers and then to final consumers, which has the smallest number of organisms. These different levels are known as trophic levels.

Conclusion and Future Direction: The vertebrates are the final steps in the food chain of our transects. We have studied the smallest bacteria, plant life, protists, invertebrates, and finally vertebrates. All the organisms are connected in that they all live in the same environment and they depend upon each other for survival. Without each other the transect would die and all the organisms would die as well.

SLS

February 18th, 2015, Invertebrates

Purpose: In this lab we examined several types of invertebrates, examined their symmetry and body cavity types in order to learn how simple systems then evolved into more complex systems. We also examined all of the invertebrates found in our Berlese Funnel from last week and classified them using a dichotomous key.

Methods and Materials: • Observed cross sections of Planaria, an acoelomate, with microscope and noted movement and lack of body cavity • Observed Nematodes, a pseudocoelomate, under dissecting microscope and noted movement • Observed earth worms, coelomates, and noted their movement and shape • Examined different preserved species of Arthropods • Analyzed contents of Berlese Funnel -Broke apart Berlese funnel -Poured top 15 mL of liquid into one petri dish -Poured the rest of the liquid into a second dish -Observed dishes under dissecting microscope -Used a dichotomous key to identify invertebrates found -Identified at least 5 invertebrates, measured organisms, and noted it’s characteristics

Data and Observations:

The worms observed all had different types of body cavities. The Planaria has no real body cavity, but do to the fact that only cross sections were observed the movement of the worm could not be seen. The nematodes have a false body cavity, they were extremely small and almost translucent. They moved in a side to side manner. The earth worms have a true body cavity, they were large pink, and moved in any way they wanted to. They could wriggle side to side, curl up, and crawl everywhere.

Within the Berlese Funnel collection there were very few organisms to be found, another groups collection was used to find organisms, although the sample was still form transect three. The range of organisms found was very large, from .5mm to 12mm. The pillbug was the largest invertebrate found, but the lice were the most common.

Table 1: Invertebrates Found in Transect Three

Organism (Phylum and class)	Length in mm	Number in Sample	Description of Organism
Biting Lice (mallophaga)	1.5 mm	3+	small, chewing mouth parts
Flea (siphonptea)	2. 1 mm	2	small, legs modified for jumping, body laterally compressed
flies (diptera)	2 mm	2	small, black, single set of wings
pillbugs (armadillidiidae)	12 mm	1	multiple body parts, 14 legs, brown, antena
sucking lice (canoplara)	.5 mm	4	sucking mouth parts, very small

Photo 1: Invertebrates Found Under Dissecting Microscope

Conclusions and Future Directions: All the worms had different movements based on how complex their inner structures were. It appears that the soil and leaf litter in transect three supports lice the best. There were two types of lice in the soil and multiple lice were found.

SLS

February 11th, 2015, Plant Life and Fungi in Transect 3

Purpose: In this lab we examined 5 plant samples from our transect, characterized their vascularization,their mechanisms of reproduction, and any specialized structures they may have in order to find out more about the functions of the plant life of the transect. We also observed fungi and noted it's important role in an ecosystem. We also set up a Berlese Funnel to collect invertebrates to study next week.

Methods and Materials: • Obtained 5 representative samples of plant life from transect 3 and took photos • Obtained leaf litter from transect • Examined cross sections of plant samples under dissecting microscope and without aid • Characterized plant vascularization • Observed any presence of specialized structures • Described shape, size, and arrangement of leaves from plant samples • Examined methods of reproduction for each plant sample • Examined fungi under a dissecting microscope • Created a Berlese Funnel to collect invertebrates for study -Obtained a 50 mL conical tube filled with 25 mL of 50:50 water/ethanol solution -Fitted a piece of screen into the bottom of a funnel, tapped screen in place -Parafiled and tapped conical tube to funnel -Placed leaf litter sample into funnel -Set up funnel on ring stand -Hung a light source above leaf litter sample and covered with foil -Left sample under light for a week in the lab

Data and Observations: The five plant samples were taken from various places around the transect. We took a variety of types of plant life such as ground flowers, large trees, small bushes, and large bushes. Vascularization and mechanisms of reproduction for the plants was determined by examining cross sections of each sample and then looking up further information. By listening to the American University Arboretum and Garden podcast most of the plant were able to be identified. All of the plants were classified as Angiosperms.Fungi was also observed in this lab. The sporangia were examined and they are important to the fungi because that is where the fungi's spores are stored. The fungi rhizopus stolonifer, a zygospore, known as bread mold was mainly looked at under the dissecting microscope. It appeared to be like a mass of fluff with black dots scattered through out. The black dots were the sporangia for the bread mold.

Table One: Description of Plant Samples

Transect Sample Plants

Location in Transect

Description

Vascularization

Specialized Structures

Mechanisms of Reproduction

Photo One: Plant Samples in Transect

Photo Two: Plant Samples in Lab

Japanese Snowbell	back right corner	branch, thin, brown, fragile, 6.8 mm		angio sperm	dicot
Cotoneaster	next to large rock	leaf, waxy, dark/deep green, short & stout, 4.3mm	dispersed in bundles	very thick cuticle, angiosperm	dicot
Tall Bush	back center	leaf, long, thin, undulating edge, light green, less waxy, 7.1mm	vascular bundles in a ring	thin cuticle, angiosperm	dicot
Dafodil	in ground in the back center	leaf sprout, long, thin, bright green, attatched to bulb in ground, 8.9mm	vascular bundles scattered	angio sperm	manocot
Chaste Tree	left middle	branch, long, thin, sturdy, red-hued, two sprouts in each end, 16.3mm	vascular bundles in a ring	angio sperm	dicot

Conclusion and Future Direction: Characterizing the variety of plants will assist us in knowing what type of organisms the plant life in the ecosystem can support and what resources the ecosystem offers to support this type of plant life. With our collection of leaf litter we will be able to study the types of invertebrates found in our transect using the Berlese Funnel collection system.

SLS

February 4th, 2015 Microbiology and Identifying Bacteria with DNA Sequences

Purpose: In this lab we examined the bacteria that grew on our agar plates, both with and without tetracycline, that we plated last week. There will be growth on the plates because there was evidence of living organisms in our Hay Infusion culture. There will most likely be more colonies on the plates without tetracycline than the plates with tetracycline, because tetracycline is an antibiotic and kills certain bacteria. We also examined our Hay Infusion one last time. It smelled the same, but most of the water had evaporated from it. Also all the soil seemed to have dissolved or decomposed.

Methods and Materials: • Examined our hay infusion, noting smell and appearance changes

• Examined all agar plates

• Counted number of colonies on each plate

• Selected 4 plates to study more thoroughly, selected 10-2, 10-4, and 10-6 all without tetracycline and 10-6 with tetracycline

• Observed Wet mounts of the bacteria from the selected plates under a microscope

• Created Gram Stains of the selected plates and observed colony color and shape, cell description, and if they are gram positive or gram negative

• Set up PCR for 16S sequencing

• Transferred single colony of bacteria into 100 micro liters of water in a sterile tube

• Incubated at 100 °C for 10 minutes in a heat block

• Centrifuged sample for 5 minutes at 13,400 rpm

• Added 20 micro liters of primer/water mixture to a labeled PCR tube

• Transferred 5 micro liters of the supernatant liquid from centrifuged samples to the 16S PCR reaction

• Placed tube in PCR machine

Data and Observation:

Table 1: 100-fold Serial Dilutions Results

Dilution	Agar Type	Colonies Counted	Conversion Factor	Colonies/mL
10^-3	nutrient	660	x10^3	660,000
10^-5	nutrient	228	x10^5	22,800,000
10^-7	nutrient	165	X10^7	1650000000
10^-9	nutrient	87	x10^9	8.7x10^10
10^-3	nutrient + tet	1000	x10^3	1,000,000
10^-5	nutrient + tet	18	x10^5	1,800,000
10^-7	nutrient + tet	8	X10^7	80,000,000
10^-9	nutrient + tet	3	x10^9	3,000,000,000

Table 2: Bacterial Characterization

Colony Label	Plate Type	Colony Description	Cell Description	Gram +/-
1	w/o tet	dark purple, raised, umbonate, wrinkles, irregular, undulated edge	nonmotile, staphylococci, 10 micrometers	Gram +
2	w/o tet	creamy white, rhizoid, glistening, raised, undulated edge	nonmotile, staphylococci, 10 micrometers	Gram +
3	w/o tet	light purple, raised, irregular, glistening, undulated edge	nonmotile, staphylococci, 50 micrometers	Gram -
4	w/ tet	orange, raised, circular, glistening, entire edged	nonmotile, coccus, 70 micrometers	Gram -

Photos of bacteria under 100x Oil Immersion

Conclusions and Future Directions: There were many differences between the plates with and without tetracycline. First of all there was many more colonies on the plates without tetracycline, and there was much more diversity in those colonies. On the plates with tetracycline only one type of bacteria that grew, and it was in very few numbers. This difference indicates that the tetracycline kills the other bacteria and only one type could survive it. Tetracycline prevents bacterial protein synthesis by not allowing aminoacyl-tRNA to meet with the ribosome. Because tetracycline disables protein synthesis in the ribosome, it will affect both gram positive and negative bacteria (Chopra).

Work Cited:

Chopra, I. Roberts, M. 2001. Tetracycline Antibiotics: Mode of Action, Applications, Molecular Biology, and Epidemiology of Bacterial Resistance. Microbiology and Molecular biology Reviews. 65: 232-260.  

SLS

January 28th, 2015 Identifying Algae and Protists in Hay Infusion and Preparing and Plating Serial Dilutions

Purpose: In this lab we examined the protists and algae, under a microscope, living in our Hay Infusion from transect three. We took samples from two different niches in our Hay Infusion. We then identified the protists and algae using a dichotomous key, which consists of a set of questions concerning the physicality of the protist or algae. Because the samples were form two different niches I expected some variability in the protists found in the samples but I also expect some overlap in protists found because they are still from the same Hay Infusion. We also prepared and plated serial dilutions of our Hay Infusion culture to study next lab.

Materials and Methods: • Hay Infusion was very carefully, as to not disturb the contents, brought over to table

• Samples were taken from two different niches in the culture, the 1st was from the top of culture, the 2nd was taken from the bottom near a berry

• A wet mount was made from each of the samples

• Wet mounts were observed under a microscope, first at 4x, next 10x, then at 40x

• All organisms were identified using a dichotomous key

• Next we prepared and plated serial dilutions of our Hay Infusion culture

• The lid was placed on our Hay Infusion culture and the jar was shaken so the contents would mix

• Four tubes with 10mL of sterile broth were labeled 10-2, 10-4, 10-6, and 10-8

• Four nutrient agar plates and four nutrient agar plates with tetracycline were labeled 10-2, 10-4, 10-6, and 10-8 on the agar side on the plate, but the plates with tetracycline were also labeled with “tet”

• 100 microliters of our Hay Infusion culture was added to the tube labeled 10-2 then the tube was swirled

• 100 microliters from tube 10-2 was added to tube 10-4, and the tube was swirled

• This entire process was repeated two more times to create the 10-6 and 10-8 dilutions

• A spreader was disinfected, by being put into an ethanol bath, then put into a flame and was allowed to cool, before being used to spread each dilution onto a plate

• 100 microliters were pipetted onto both the agar nutrient plate and the agar nutrient plate with tetracycline

• Then the dilutions were spread onto their respective plates

• This process was repeated three more times for each dilution

• Plates were then placed on a rack to incubate for a week

Data and Observations: The Hay Infusion culture appeared to have several clumps of soil floating at the top, but there wasn't plant life growing in it. The culture smelled like stagnant water and mold, it was rather unpleasant. There were various different kinds of protists and algae found in the samples taken from our Hay Infusion culture. In sample 1, taken from layer, bursaria truncatella, gonium, and pelomyxa were found. In sample 2, taken around a berry at the bottom, colpidium, chlamydomonas, and blepharisma were found.

Table 1: Organisms found in Hay Infusion Culture

Sample	Organism	Size (micrometers)	Motile?	Protist or Algae
1	Bursaria Truncatella	90	yes	Protist
1	Gonium	100	no	Algae
1	Pelomyxa	300	yes	Protist
2	Colpidium	300	yes	Protist
2	Chlamydomonas	30	yes	Algae
2	Blepharisma	400	yes	Protist

Photo One:

Photo Two:

Conclusions and Future Directions: It was surprising that there were several different species found living in the different niches, even though they came from the same Hay Infusion culture. But it is understandable because some of the organisms were found near plant life, the berry. The organisms near plant life may differ because they could use the plant life as a food source or it needs the same conditions as plant life to survive. One organism we found that does this is the chlamydomonas. Chlamydomonas is a unicellular green algae found in stagnant water, damp soil, or even snow. This organism meets the requirements for life because it is a membrane bound cell, obtains it's energy through photosynthesis, passes genetic information on through both asexual and sexual reproduction, and it is a product of evolution. If my Hay Infusion were to "grow" for another two months I would expect to see more diversity of organisms present due to more things decaying and then being available as a food source.

SLS

January 26th, 2015 Biological Life at AU

Purpose:In this lab we began our study of a, roughly, 20 by 20 meter transect of land here at American University. From that transect we will take a soil and plant life sample, create a Hay infusion from the sample, and then discover what type of protists are found in our transect. By collecting samples from our transect, and observing it over several weeks we are able to study the community living in the transect. Through our study of the community in our transect we can discover the different niches, or the precise environmental necessities in their ecosystems, that the organisms have. All of this observing of organisms and our transect will aid in our study of biodiversity.

Materials and Methods:

• My group’s transect is number three, or the tall bushes transect.

• Group members observed the 20 by 20 area

• Drew an aerial view of the transect and took pictures of the area

• Collect soil and ground vegetation sample in a 50mL sterile tube

• Taking the sample back to lab we began to make our Hay Infusion

• Measure out 10-12 grams of the soil/vegetation sample

• Add the sample to a labeled plastic jar containing 500mL of water

• Measure out 0.1 grams of dried milk

• Add the dried milk to the soil and water mixture

• Put the lid on the jar and mix the contents of the jar together for about 10 seconds

• Take the lid off the jar and leave it in the lab for the week

Data and Observations: Within our transect we observed many abiotic and biotic factors in it. In our transect some of the biotic factors we observed were the bushes, trees, squirrels, birds, and spiders. Some of the abiotic components were rocks, metal plaques, the soil, snow, and we even found a rat trap in our transect.

Images of Transect Three:

Conclusions and Observations: Due to the several biotic components in our transect there will likely be many protists in our hay infusion. It is unlikely that our transect will change drastically over the next few weeks. So the abiotic and biotic components in the transect should remain the same.

SLS

January 21st, 2015

This is my first post for Bio 210.

SLS