User:Sean P Corum/Notebook/PHIX174 Cell Free/2012/07/24: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 14: Line 14:
**# GCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGATACTTGGAACAATTTCTGGAAAGACGG(77-mer, T<sub>m</sub> = 67°C, annealing T = 72°C) = 2566nM or ~2.6×10<sup>5</sup>X amplification
**# GCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGATACTTGGAACAATTTCTGGAAAGACGG(77-mer, T<sub>m</sub> = 67°C, annealing T = 72°C) = 2566nM or ~2.6×10<sup>5</sup>X amplification
**# pWhitescript positive control, CCATGATTACGCCAAGCGCGCAATTAACCCTCAC (34-mer, T<sub>m</sub> = 64 °C, annealing T = 69 °C) = 936nM or ~1.3×10<sup>5</sup>X amplification
**# pWhitescript positive control, CCATGATTACGCCAAGCGCGCAATTAACCCTCAC (34-mer, T<sub>m</sub> = 64 °C, annealing T = 69 °C) = 936nM or ~1.3×10<sup>5</sup>X amplification
**ANALYSIS: the level of amplification correlates to the N-mer length with R<sup>2</sup>=0.706, whereas it corresponds to the melting temperature with R<sup>2</sup>=0.298 and the annealing temperature with R<sup>2</sup>=0.554. The length corresponds to the annealing temperature with R<sup>2</sup>=0.560 and to the melting temperature with R<sup>2</sup>=0.244. When the pWhitescript positive control data point is excluded, these R<sup>2</sup> values change to ''0.921'', 0.230, ''0.743'', ''0.940'', and 0.500.
**ANALYSIS: the level of amplification correlates to the N-mer length with R<sup>2</sup>=0.706, whereas it corresponds to the melting temperature with R<sup>2</sup>=0.298 and the annealing temperature with R<sup>2</sup>=0.554. The length corresponds to the annealing temperature with R<sup>2</sup>=0.560 and to the melting temperature with R<sup>2</sup>=0.244. When the pWhitescript positive control data point is excluded, these R<sup>2</sup> values change to ''0.921'', 0.230, ''0.743'', ''0.940'', and 0.500, respectively.
**DISCUSSION: Longer N-mers, which have corresponding higher annealing temperatures, give better amplification during whole plasmid PCR. Therefore, N-mer length and annealing temperature, which correlate with each other, are key factors that should be increased when choosing primers for whole plasmid PCR.  Melting temperature is not important, as long as it is above the 55 °C annealing step during the PCR reaction.  N-mer length should also probably not be too large, since self-annealing or other structure formation may reduce PCR efficiency at some point. For practical reasons, N-mer length should probably be ~≤ 100b ideally.
**DISCUSSION: Longer N-mers, which have corresponding higher annealing temperatures, give better amplification during whole plasmid PCR. Therefore, N-mer length and annealing temperature, which correlate with each other, are key factors that should be increased when choosing primers for whole plasmid PCR.  Melting temperature is not important, as long as it is above the 55 °C annealing step during the PCR reaction.  N-mer length should also probably not be too large, since self-annealing or other structure formation may reduce PCR efficiency at some point. For practical reasons, N-mer length should probably be ~≤ 100b ideally.
**CONCLUSION: For this whole plasmid PCR, I will use the 77-mer primers (labeled ΦX174 3 S and ΦX174 3 AS).
**CONCLUSION: For this whole plasmid PCR, I will use the 77-mer primers (labeled ΦX174 3 S and ΦX174 3 AS).

Revision as of 14:36, 24 July 2012

PHIX174 Cell Free Expression <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Hypothesis 2: Gene L is necessary for phage propagation.

  • From yesterday's whole plasmid PCR of ΦX174...
    • Quantifluore result:
      1. GATATTTTTCATGGTATTGATAAAGCTGTTGCCGATACTTGGAAC (45-mer, Tm = 63 °C, annealing T = 58 °C) = 1020nM or ~1.0×105X amplification from 0.1nM template
      2. GGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGATACTTGGAACAATTTCTGG (63-mer, Tm = 69 °C, annealing T = 64 °C) = 1447nM or ~1.5×105X amplification
      3. GCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGATACTTGGAACAATTTCTGGAAAGACGG(77-mer, Tm = 67°C, annealing T = 72°C) = 2566nM or ~2.6×105X amplification
      4. pWhitescript positive control, CCATGATTACGCCAAGCGCGCAATTAACCCTCAC (34-mer, Tm = 64 °C, annealing T = 69 °C) = 936nM or ~1.3×105X amplification
    • ANALYSIS: the level of amplification correlates to the N-mer length with R2=0.706, whereas it corresponds to the melting temperature with R2=0.298 and the annealing temperature with R2=0.554. The length corresponds to the annealing temperature with R2=0.560 and to the melting temperature with R2=0.244. When the pWhitescript positive control data point is excluded, these R2 values change to 0.921, 0.230, 0.743, 0.940, and 0.500, respectively.
    • DISCUSSION: Longer N-mers, which have corresponding higher annealing temperatures, give better amplification during whole plasmid PCR. Therefore, N-mer length and annealing temperature, which correlate with each other, are key factors that should be increased when choosing primers for whole plasmid PCR. Melting temperature is not important, as long as it is above the 55 °C annealing step during the PCR reaction. N-mer length should also probably not be too large, since self-annealing or other structure formation may reduce PCR efficiency at some point. For practical reasons, N-mer length should probably be ~≤ 100b ideally.
    • CONCLUSION: For this whole plasmid PCR, I will use the 77-mer primers (labeled ΦX174 3 S and ΦX174 3 AS).
    • NEXT STEPS:
      • Optimize primer concentration using a range of 100, 200, 1000, and 2000 nM primers.
      • Use PFU ligase during the PCR reaction to repair the nicked DNA.
      • Mutagentic whole plasmid PCR to create the ΦX174 L21STOP mutant.
    • Gel electrophoresis result (same labels as above)


Retrieved from "https://openwetware.org/mediawiki/index.php?title=User:Sean_P_Corum/Notebook/PHIX174_Cell_Free/2012/07/24&oldid=615349"