User:Sean P Corum/Notebook/PHIX174 Cell Free/2012/07/10: Difference between revisions
From OpenWetWare
Sean P Corum (talk | contribs) m (→Entry title) |
Sean P Corum (talk | contribs) |
||
Line 33: | Line 33: | ||
* Primers amplified pWhitescript without any problem. Characterizing these using [http://www.neb.com/nebecomm/tech_reference/TmCalc/Default.asp#.T_3_w3ixm18 NEB Tm Calculator]: | * Primers amplified pWhitescript without any problem. Characterizing these using [http://www.neb.com/nebecomm/tech_reference/TmCalc/Default.asp#.T_3_w3ixm18 NEB Tm Calculator]: | ||
** Sense primer: CCATGATTACGCCAAGCGCGCAATTAACCCTCAC, annealing T 64 °C, melting T 69 °C | ** Sense primer: CCATGATTACGCCAAGCGCGCAATTAACCCTCAC, annealing T 64 °C, melting T 69 °C | ||
** Antisense primer: | ** Antisense primer: GTGAGGGTTAATTGCGCGCTTGGCGTAATCATGG, annealing T 64 °C, melting T 69 °C | ||
* On the other hand, my primers for ΦX174 give: | * On the other hand, my primers for ΦX174 give: | ||
** | ** ΦX174 sense primer 1: GATATTTTTCATGGTATTGATAAAGCTGTTGCCGATACTTGGAAC, annealing T 57 °C, melting T 63 °C | ||
** | ** ΦX174 antisense primer: CTATAAAAAGTACCATAACTATTTCGACAACGGCTATGAACCTTG, annealing T 57 °C, melting T 62 °C | ||
* Supposing that temperature is the problem, it appears I need to increase annealing and melting temperatures of my primers to 64 °C and 69 °C, respectively. | * Supposing that temperature is the problem, it appears I need to increase annealing and melting temperatures of my primers to 64 °C and 69 °C, respectively. | ||
** ΦX174 sense primer 1: CTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGATACTTGGAACAATTTCTGG, annealing T 57 °C, melting T 63 °C | |||
** ΦX174 antisense primer: CTATAAAAAGTACCATAACTATTTCGACAACGGCTATGAACCTTG, annealing T 57 °C, melting T 62 °C | |||
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | ||
__NOTOC__ | __NOTOC__ |
Revision as of 16:16, 11 July 2012
PHIX174 Cell Free Expression | <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page <html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html> </html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html> |
Characterization B: Expression of PHIX174 promoters fused to UTR1-deGFP.
Characterization C: Expression of PHIX174 promoters fused to UTRX-deGFP.
Hypothesis 2: Gene L is necessary for phage propagation.
|