User:Sean P Corum/Notebook/PHIX174 Cell Free/2012/06/18: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
mNo edit summary
mNo edit summary
Line 1: Line 1:
{|{{table}} width="800"
{|{{table}} width="800"
|-
|-
|style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;"> Project name</span>
|style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;"> PHIX174 Cell Free Expression</span>
|style="background-color: #F2F2F2" align="center"|<html><img src="/images/9/94/Report.png" border="0" /></html> [[{{#sub:{{FULLPAGENAME}}|0|-11}}|Main project page]]<br />{{#if:{{#lnpreventry:{{FULLPAGENAME}}}}|<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>[[{{#lnpreventry:{{FULLPAGENAME}}}}{{!}}Previous entry]]<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>}}{{#if:{{#lnnextentry:{{FULLPAGENAME}}}}|[[{{#lnnextentry:{{FULLPAGENAME}}}}{{!}}Next entry]]<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>}}
|style="background-color: #F2F2F2" align="center"|<html><img src="/images/9/94/Report.png" border="0" /></html> [[{{#sub:{{FULLPAGENAME}}|0|-11}}|Main project page]]<br />{{#if:{{#lnpreventry:{{FULLPAGENAME}}}}|<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>[[{{#lnpreventry:{{FULLPAGENAME}}}}{{!}}Previous entry]]<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>}}{{#if:{{#lnnextentry:{{FULLPAGENAME}}}}|[[{{#lnnextentry:{{FULLPAGENAME}}}}{{!}}Next entry]]<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>}}
|-
|-

Revision as of 14:00, 21 June 2012

PHIX174 Cell Free Expression <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

June 18, 2012: Initial entry for PHIX174 research project

SC 17:54, 18 June 2012 (EDT)

Research Log

The current log for this research project is linked to here: PHIX174_Research_Log_Jun-18-2012.txt. It will be updated at the beginning of each week. I am currently working on Characterization B and Hypothesis 2.

Characterization B: Expression of PHIX174 promoters fused to UTR1-deGFP.

Previous attempts at cloning a UTR1-deGFP linker into pBEST-pA-BamHI//XhoI-T500 backbone have failed. Sequencing showed a systematic error, whereby a truncated ~100bp piece was ligated, instead of the full UTR1-deGFP linker. Re-digesting and purifying the backbone showed the same result. Therefore, I am focusing on the linker. My hypothesis is that the PCR was mis-primed, so I designed a different set of primers to make the BamHI-UTR1-deGFP-XhoI linker. They were received today.

  • BamHI-UTR1-deGFP-XhoI-T500 sense primer: AATAATTTTGTTTAACTTTAAGAAGGAGATA, 31b, TH = 57.6 °C
  • BamHI-UTR1-deGFP-XhoI-T500 antisense primer: ATGATAAAGAAGACAGTCATAAGTGC, 26b, TH = 57.3 °C
  • Template: pBEST-OR2OR1Pr-UTR1-deGFP-T500
  • PCR product size: 861 bp (after double digestion with BamHI and XhoI, size of BamHI-UTR1-deGFP-XhoI sticky linker will be 847 bp).
  • Using these primers and template, I performed standard PCR with TH = 58 °C, 24 cycles, and an elongation time of 1 min.

Hypothesis 2: Gene L is necessary for phage propogation.

Over the weekend, I attempted whole plasmid PCR to amplify PHIX174 by whole plasmid PCR (non-mutagenic primers) by the method described in Chen and Ruffner. No amplification observed. One line at 45b observed, corresponding to self-hybridization of the primers.

Notes


Retrieved from "https://openwetware.org/mediawiki/index.php?title=User:Sean_P_Corum/Notebook/PHIX174_Cell_Free/2012/06/18&oldid=609300"